Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_013198 1,038,046 Δ860 bp [LGG_01023]–is36 [LGG_01023], is35, is36

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_013198 1038046–1038902 1038905 4–860 94 [1] [0] 93 [LGG_01023]–is36 [LGG_01023], is35, is36

New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 10380451 (0.012)91 (1.084) 43/290 0.3 coding (872/978 nt) LGG_01023 adenine specific DNA methylase Mod
?NC_013198 1038906 = 0 (0.000)intergenic (+13/‑238) is36/LGG_01026 transposase IS4 family protein/type III restriction‑modification system methylation subunit
Continuation Left: 0 Continuation Right:0

Only 100 of 101 total aligned reads displayed.

ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAG......................................................................................................................................................  .  NC_013198/1037891‑1038045
......................................................................................................................................................CTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  .  NC_013198/1038906‑1039055
                                                                                                                                                                                                                                                                                                                 
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            >  2:116027/1‑151
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            <  1:974146/151‑1
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            <  2:943359/151‑1
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            >  1:520961/1‑151
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            <  1:417598/151‑1
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  1:316063/1‑151
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  1:578534/1‑151
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  2:88260/1‑151
     TAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGG                                                                                                                                                       >  1:219597/1‑151
     TAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGG                                                                                                                                                       >  2:778631/1‑151
      agCCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGG                                                                                                                                                      <  1:784657/149‑1
      AACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGG                                                                                                                                                      >  1:152808/1‑151
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGTAGCCCAAACCTAAGGGC                                                                                                                                                     >  2:621526/1‑151
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     >  1:775552/1‑151
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     <  2:759767/151‑1
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     >  2:393853/1‑151
        tCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCt                                                                                                                                                    >  2:784424/2‑150
          ATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAAC                                                                                                                                                  >  2:173521/1‑151
          ATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCAAGACAACGACTCAAATGGAGCGTGGAGAGAAGGAGATGTTAGAAGCCCAAACCTAAGGGCAAC                                                                                                                                                  >  2:743051/1‑151
            ACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACAT                                                                                                                                                >  2:693220/1‑151
            ACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACAT                                                                                                                                                >  2:709384/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCACCATTACGc                                                                                                                                           >  1:488795/1‑150
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           >  2:660693/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           >  1:365432/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           >  2:947876/1‑151
                    TTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATAT                                                                                                                                        <  2:18826/151‑1
                      ATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGTCAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAA                                                                                                                                      >  2:163166/1‑151
                       TGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAAT                                                                                                                                     >  1:8846/1‑151
                         CTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATAT                                                                                                                                   <  1:366427/151‑1
                         CTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATAT                                                                                                                                   <  2:887825/151‑1
                         CTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATAT                                                                                                                                   <  2:816286/151‑1
                            AGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTAC                                                                                                                                <  2:870973/151‑1
                            AGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTAC                                                                                                                                <  1:173513/151‑1
                            AGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTAC                                                                                                                                <  2:950596/151‑1
                            AGAACATAAATAAAGTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTAC                                                                                                                                <  1:75205/151‑1
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              >  2:201012/1‑151
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              <  1:81988/151‑1
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              <  2:555035/151‑1
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              <  2:306880/151‑1
                               ACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGC                                                                                                                             >  2:165788/1‑151
                               ACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGC                                                                                                                             <  1:517742/151‑1
                                 ATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTC                                                                                                                           <  2:905608/151‑1
                                      TAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAAT                                                                                                                      <  2:220025/151‑1
                                        AATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGa                                                                                                                    >  2:77987/1‑150
                                        AATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGG                                                                                                                    >  1:602150/1‑151
                                          TTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAA                                                                                                                  <  1:112568/151‑1
                                                   TTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTT                                                                                                         <  1:544946/151‑1
                                                                   cccCAAAGCGTAATACAAATTCTTCAAAACCACACCACGCCTCAACAGGAGTGATTAGTGCAGGTGACCATAGGCACCCAAACCTAAGCCCACCATTTCGACATAATATTACTGCTCCCACTGCAAAGCCCATTTTTCCACCGAAACATGG                                                                                         >  2:342847/4‑151
                                                                   CATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGG                                                                                         >  1:739186/1‑151
                                                                   CATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGG                                                                                         >  2:174682/1‑151
                                                                     TCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGT                                                                                       >  2:481290/1‑151
                                                                     TCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGATAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGT                                                                                       >  2:491312/1‑151
                                                                          GGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGA                                                                                  >  1:337782/1‑151
                                                                          GGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGA                                                                                  >  2:384295/1‑151
                                                                             TAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGG                                                                               >  2:547611/1‑151
                                                                              AATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGT                                                                              >  1:96958/1‑151
                                                                              AATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGT                                                                              >  2:504805/1‑151
                                                                              AATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGT                                                                              >  1:358106/1‑151
                                                                               ATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTC                                                                             >  2:962143/1‑151
                                                                               ATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTC                                                                             >  2:423206/1‑151
                                                                               ATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTC                                                                             >  2:299849/1‑151
                                                                                    AACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAG                                                                        <  1:292699/151‑1
                                                                                     ACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGA                                                                       <  1:83379/151‑1
                                                                                                     CAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAA                                                       <  2:219604/151‑1
                                                                                                     CAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAA                                                       >  2:590624/1‑151
                                                                                                         GACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCA                                                   >  2:345731/1‑151
                                                                                                         GACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCA                                                   >  2:479123/1‑151
                                                                                                           CTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAA                                                 >  2:369452/1‑151
                                                                                                           CTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAA                                                 >  1:603847/1‑151
                                                                                                             CAAATGGATCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTTCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               <  2:728791/151‑1
                                                                                                             CAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               >  2:356327/1‑151
                                                                                                             CAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               >  1:936441/1‑151
                                                                                                             CAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               >  2:538339/1‑151
                                                                                                                  GGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAG                                          >  1:475848/1‑151
                                                                                                                     GCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAG                                       <  2:358239/151‑1
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  1:529234/1‑151
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  2:505853/1‑151
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  2:930380/1‑151
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  1:741489/1‑151
                                                                                                                          GAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTT                                  >  2:775372/1‑151
                                                                                                                          GAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTT                                  >  1:182806/1‑151
                                                                                                                            GAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTT                                >  2:65050/1‑151
                                                                                                                               CAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAA                             >  1:397977/1‑151
                                                                                                                                 GGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGC                           <  1:813369/151‑1
                                                                                                                                    GATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTG                        >  2:319607/1‑151
                                                                                                                                    GATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTG                        >  1:842922/1‑151
                                                                                                                                    GATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTG                        >  2:133958/1‑151
                                                                                                                                    GATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTG                        >  1:355390/1‑151
                                                                                                                                         TAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAAT                   >  2:481809/1‑151
                                                                                                                                           GGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTC                 <  2:950830/151‑1
                                                                                                                                              GCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGG              >  1:374190/1‑151
                                                                                                                                                  AAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATC          <  2:731897/151‑1
                                                                                                                                                    ACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCAT        >  1:351973/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTTCCAATGGAAAGACCATTTTCCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  2:193111/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  1:385506/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  1:945815/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  1:548281/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  2:720685/1‑151
                                                                                                                                                          GGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  <  1:363712/151‑1
                                                                                                                                                          GGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  >  1:215581/1‑151
                                                                                                                                                                                                                                                                                                                 
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAG......................................................................................................................................................  .  NC_013198/1037891‑1038045
......................................................................................................................................................CTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  .  NC_013198/1038906‑1039055

Base quality scores:  ATCG  < 3 ≤  ATCG  < 18 ≤  ATCG  < 29 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG