Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_013198 1,877,309 Δ1,586 bp LGG_01848 LGG_01848

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_013198 1877309 1878894 1586 69 [0] [0] 69 LGG_01848 LGG_01848

New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 18773080 (0.000)63 (0.772) 41/282 0.4 intergenic (‑337/‑114) LGG_01847/LGG_01848 membrane protein/hypothetical protein
?NC_013198 1878895 = 0 (0.000)intergenic (+70/‑60) LGG_01848/tRNA‑Leu hypothetical protein/tRNA‑Leu
Continuation Left: 0 Continuation Right:0

ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTA....................................................................................................................................................  .  NC_013198/1877152‑1877308
.....................................................................................................................................................CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  .  NC_013198/1878895‑1879042
                                                                                                                                                                                                                                                                                                                  
ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGC                                                                                                                                                            <  1:209487/151‑1
ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACCCTTAATGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGC                                                                                                                                                            >  1:899588/1‑151
 CCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCT                                                                                                                                                           >  2:240841/1‑151
 CCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCACCCCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGAGTAATGGCCCAAGCCCGGCCACTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGCTCGCGCT                                                                                                                                                           >  2:633216/1‑151
            GCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTC                                                                                                                                                <  1:792644/151‑1
               TGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTAT                                                                                                                                             <  1:933441/151‑1
                GGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATT                                                                                                                                            >  1:843129/1‑151
                  GTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGA                                                                                                                                          >  2:233123/1‑151
                       AGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCCTAATGGCCCAAGCCCGGACATTACGCTTAAGGCCACTTACACTCCGGATTCTAAGCGAGCCGGCTCGCGCTTAGTAAATTTCTATTGACTTaa                                                                                                                                     >  1:78326/1‑149
                       AGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCATGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTA                                                                                                                                     >  2:794018/1‑151
                        GCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAA                                                                                                                                    >  1:263387/1‑151
                         CTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAAT                                                                                                                                   >  2:560485/1‑151
                          TTATGCCCTGGACGCGCCCTCCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCTTAATGGCCCAAGCCCGGCCATTACGCTTTAGGCCACTTACACTCCGGTTTCTAAGCGCTCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATC                                                                                                                                  <  2:70276/151‑1
                           TATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCT                                                                                                                                 <  2:741616/151‑1
                               CCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACG                                                                                                                             <  2:681189/151‑1
                               CCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACG                                                                                                                             >  1:130454/1‑151
                                 CTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCANTTACACTCNNGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTT                                                                                                                           >  1:316426/1‑151
                                                GGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTC                                                                                                            <  1:830976/151‑1
                                                 GCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCT                                                                                                           >  1:561777/1‑151
                                                   GCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTG                                                                                                         >  1:806381/1‑151
                                                      GAAACCTGCGTGTAAG.GCCCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGC                                                                                                      <  1:563280/151‑1
                                                      GAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGC                                                                                                      <  2:969312/151‑1
                                                               GTGTAAGTGGCCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAG                                                                                              >  1:990370/1‑151
                                                                TGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTC                                                                                            >  2:73622/1‑151
                                                                 GTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCA                                                                                           >  1:637413/1‑151
                                                                 GTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCA                                                                                           >  2:917450/1‑151
                                                                       ggCCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      <  2:990105/149‑1
                                                                       GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTACGCGCGCCGGTTCGCGCTTAGCAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  2:508386/1‑151
                                                                       GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  2:35998/1‑151
                                                                       GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  1:20599/1‑151
                                                                         CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  1:475977/1‑151
                                                                         CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  1:375594/1‑151
                                                                         CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  2:873844/1‑151
                                                                         CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  2:821125/1‑151
                                                                               GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  1:342528/1‑151
                                                                               GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  1:301492/1‑151
                                                                               GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  1:57148/1‑151
                                                                                  TAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAA                                                                           >  1:701317/1‑151
                                                                                      ggccgggcttgGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGG                                                                       >  1:578210/12‑151
                                                                                      ggaCCAAGCCCGGCCATTACGCTTAAGGCCTCTTACACTCCGGTTTCTAAGCGCCCCGCTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAAattg                                                                       >  2:886866/4‑147
                                                                                      GGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGG                                                                       >  1:831544/1‑151
                                                                                       GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  2:600487/1‑151
                                                                                       GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  1:819167/1‑151
                                                                                            AGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGcaatgggtgacc                                                                 >  2:63801/1‑139
                                                                                                   CCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAACTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGA                                                          >  1:211552/1‑151
                                                                                                         CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    >  1:671489/1‑151
                                                                                                         CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  1:240833/151‑1
                                                                                                         CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    >  2:59702/1‑151
                                                                                                         CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  2:57148/151‑1
                                                                                                          GCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGA                                                   >  1:162805/1‑151
                                                                                                          GCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGA                                                   >  1:737895/1‑151
                                                                                                           CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  <  2:8397/151‑1
                                                                                                             TAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCT                                                >  1:874981/1‑151
                                                                                                                GGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGT                                             >  2:275527/1‑151
                                                                                                                 GCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTG                                            <  2:334238/151‑1
                                                                                                                 GCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTG                                            <  1:749191/151‑1
                                                                                                                   CACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAG                                          >  1:421088/1‑151
                                                                                                                   CACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAG                                          >  1:843339/1‑151
                                                                                                                     CTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGTGCCAGAATAAGGAACCTGTGAGCA                                        >  2:12229/1‑151
                                                                                                                     CTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACCCGCAAGATTAAGGATATTGTGAGCA                                        >  2:327423/1‑151
                                                                                                                      TTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCAT                                       <  1:563959/151‑1
                                                                                                                           CTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTG                                  >  2:672603/1‑151
                                                                                                                           CTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTG                                  >  2:868189/1‑151
                                                                                                                             CCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCAGTTTTGCT                                >  1:410214/1‑151
                                                                                                                                             CCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTC                <  1:821370/151‑1
                                                                                                                                                   CGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTG          <  1:771415/151‑1
                                                                                                                                                    GCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTCTTGCTCATGGAAGGTCGAGTCTTCTTGC         >  2:666413/1‑151
                                                                                                                                                     CGCTTAGTAAATTTCTATTGACTTTAATCTCGCGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  2:162814/151‑1
                                                                                                                                                     CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  2:176103/151‑1
                                                                                                                                                     CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  1:390876/151‑1
                                                                                                                                                     CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  2:600292/151‑1
                                                                                                                                                           GTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  <  1:874109/151‑1
                                                                                                                                                           GTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAACTTGTGAGCATTTTTGGTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  >  2:277125/1‑151
                                                                                                                                                                                                                                                                                                                  
ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAG.GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTA....................................................................................................................................................  .  NC_013198/1877152‑1877308
.....................................................................................................................................................CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  .  NC_013198/1878895‑1879042

Base quality scores:  ATCG  < 3 ≤  ATCG  < 10 ≤  ATCG  < 25 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG