New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 2406720 (0.000)97 (1.148) 39/292 0.5 coding (716/759 nt) LGG_00234 hypothetical protein
?NC_013198 241548 = 0 (0.000)intergenic (+21/‑25) is8/LGG_00237 transposase IS4 family protein/hypothetical protein
Continuation Left: 0 Continuation Right:0

GGTCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAA......................................................................................................................................................  .  NC_013198/240521‑240672
.....................................................................................................................................................CTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAT  .  NC_013198/241548‑241697
                                                                                                                                                                                                                                                                                                               
GGTCTATTTCCGGCAGGCAGTCATCTTGGCGGGGGTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGGTTCCCTTTGTGGTTGCCCAAGGTGCTA                                                                                                                                                         >  1:202467/1‑151
  TCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAT                                                                                                                                                       <  2:847169/151‑1
  TCTATTTCCGGCAGGCAGTCATCTTGGCGGGGGTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGGAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGGTTTCATTTGTGATTGCCCAAGGTGCTAAT                                                                                                                                                       >  1:94177/1‑151
    TATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTTCTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCC                                                                                                                                                     <  2:969743/151‑1
    TATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCC                                                                                                                                                     <  1:747482/151‑1
    TATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCC                                                                                                                                                     <  2:746885/151‑1
    TATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCC                                                                                                                                                     <  1:26360/151‑1
    TATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCC                                                                                                                                                     <  1:197147/151‑1
     ATTTCCGGCAGGCAGTCATCTTGGCGGGGTTTTTTTGTACTTTTTGGCGATGGCATTATTCCCGCTCATCATGGGTAATGCGGTTGCTGCCTTTGCCGGCATTTCCGCGGGCGTTGGGGTTTCCCTTT.TTATTGCCCAAGGGGGTAATCCc                                                                                                                                                    >  2:341629/1‑150
      TTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAGTCCTG                                                                                                                                                   <  2:832907/151‑1
                   GTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGGAATGCGTTTGCTGCCTTTGCCGTCATTACGGGGG.CGATTGGGATTCCATTTTTGATTTCCCCAGGGGCTAAACCTGCGAACGTTGCGGC                                                                                                                                      >  2:913402/1‑151
                               GGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGAC                                                                                                                          >  1:385315/1‑151
                                  agATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTC                                                                                                                       <  2:751539/149‑1
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCt                                                                                                                     >  1:751772/1‑150
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:26400/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:16749/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:147647/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  1:958909/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  1:656370/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:934223/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:799364/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  2:844143/1‑151
                                    ATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCG                                                                                                                     >  1:200163/1‑151
                                     TTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGG                                                                                                                    >  2:736014/1‑151
                                      TTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGT                                                                                                                   >  2:591720/1‑151
                                      TTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGT                                                                                                                   <  2:618937/151‑1
                                       TTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTT                                                                                                                  <  1:440755/151‑1
                                       TTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTT                                                                                                                  <  1:772676/151‑1
                                         GTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTAT                                                                                                                >  1:612448/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCCAGGTGCTCATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGagg                                                                                                           >  2:348110/1‑148
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  1:976805/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  1:964815/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:467717/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:127922/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:693317/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:705058/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  1:278239/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:943064/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGG                                                                                                           >  1:673024/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGGTATTGCGG                                                                                                           >  1:348567/1‑151
                                              GTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGGGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACCTCCGGTTATTGCGG                                                                                                           >  1:659770/1‑151
                                              GTGTGGCGATGGCATTATTCACGACCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGACCAAGGCGCTAATCCGGCGATAGTTGCGGCCATTAGGATGACTTCCGGTTATTGCGG                                                                                                           >  2:106811/1‑151
                                                 TGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCAC                                                                                                        <  2:342229/151‑1
                                                      ATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTAT                                                                                                   <  1:495168/151‑1
                                                        GGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTG                                                                                                 >  2:746089/1‑151
                                                        GGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTG                                                                                                 <  1:943329/151‑1
                                                        GGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTG                                                                                                 <  2:198671/151‑1
                                                         GCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGA                                                                                                >  1:900492/1‑151
                                                         GCATCATTCACGATCATCATGGGAAAGGCGATTGCTGCCGTTGCCGCCATTACGGAGA.CGATTGGGATTGTAATTGGGACTGTCCACGGTGCTTATTTTTCGACCGTTGTGGCCATTGGGAGGGCTTCCGGTTATTGCGGCACCTTATTta                                                                                                >  2:252908/1‑149
                                                          CATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAC                                                                                               <  1:592628/151‑1
                                                           ATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACC                                                                                              <  1:746322/151‑1
                                                           ATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACC                                                                                              <  1:721011/151‑1
                                                           ATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACC                                                                                              <  2:335261/151‑1
                                                           ATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACC                                                                                              <  2:326180/151‑1
                                                           ATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACC                                                                                              <  1:656377/151‑1
                                                             TATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCC                                                                                            <  2:95482/151‑1
                                                              ATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCT                                                                                           >  1:117834/1‑151
                                                                   CGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGC                                                                                      <  1:591873/151‑1
                                                                     ATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAG                                                                                    <  2:602064/151‑1
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCCGCG                                                                                  >  2:507649/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  1:859520/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  2:574324/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  2:421620/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  2:928666/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  1:14825/1‑151
                                                                       CATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCG                                                                                  >  2:261315/1‑151
                                                                        ATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGA                                                                                 >  2:776953/1‑151
                                                                        ATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGA                                                                                 >  2:119092/1‑151
                                                                        ATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGA                                                                                 >  1:891722/1‑151
                                                                             GGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTC                                                                            >  1:389017/1‑151
                                                                             GGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTC                                                                            >  1:890765/1‑151
                                                                                TAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAAT                                                                         <  2:389004/151‑1
                                                                                TAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAAT                                                                         <  2:58342/151‑1
                                                                                  ttgctgtggtTGCCTTTGCCGTTTTTACTGTGG.CGATTGGGTGTCTATTTGGTATTGCCCAGGGTTTTATTCCTGCGTTCGTTGCGGCCATTGGTATGTCTTCCGGTTATTGCGGCACCTTATTGACCCCTCTGGCAGCTAATTTTAATAG                                                                       <  2:114205/141‑1
                                                                                       TTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTAC                                                                  <  2:715862/151‑1
                                                                                                       TCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGA                                                  >  2:785993/1‑151
                                                                                                        CATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAA                                                 >  1:350809/1‑151
                                                                                                                  G.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATC                                       <  1:198456/151‑1
                                                                                                                  G.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATC                                       >  1:908964/1‑151
                                                                                                                      ATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCAT                                    >  1:896329/1‑151
                                                                                                                          GGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGGCTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGAAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGCTCCATTGGG                                >  2:910687/1‑151
                                                                                                                          GGATTCCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGG                                >  1:364560/1‑151
                                                                                                                               CCATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCA                           >  2:892568/1‑151
                                                                                                                                 ATTTGTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATT                         >  2:882996/1‑151
                                                                                                                                     GTGATTGCCCAAGGTGCTAATCCTGCTATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGC                     <  2:346583/151‑1
                                                                                                                                     GTGATTGCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGC                     <  1:542795/151‑1
                                                                                                                                           GCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGG               >  1:675171/1‑151
                                                                                                                                           GCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGG               >  2:177394/1‑151
                                                                                                                                           GCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGG               >  2:931593/1‑151
                                                                                                                                           GCCCAAGGTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGG               >  1:241800/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCCGCAGGCACCCAT        >  2:191107/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAc        >  1:759067/1‑150
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAT        >  2:972946/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAT        >  2:707953/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAT        >  1:960326/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAT        >  2:361876/1‑151
                                                                                                                                                  GTGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAT        >  2:442763/1‑151
                                                                                                                                                   TGCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATC       >  1:752869/1‑151
                                                                                                                                                        ATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAT  <  1:221652/151‑1
                                                                                                                                                                                                                                                                                                               
GGTCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAA......................................................................................................................................................  .  NC_013198/240521‑240672
.....................................................................................................................................................CTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAT  .  NC_013198/241548‑241697

Base quality scores:  ATCG  < 3 ≤  ATCG  < 8 ≤  ATCG  < 24 ≤  ATCG  < 32 ≤  ATCG  < 40 ≤  ATCG