Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_013198 594,624 Δ1,586 bp LGG_00589 LGG_00589

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_013198 594624–596201 596209 9–1586 89 [0] [0] 89 LGG_00589 LGG_00589

New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 5946230 (0.000)84 (1.029) 35/282 0.6 intergenic (‑105/+61) yicL/LGG_00589 carboxylate/amino acid/amine transporter/hypothetical protein
?NC_013198 596210 = 0 (0.000)intergenic (‑123/+83) LGG_00589/LGG_00590 hypothetical protein/hypothetical protein
Continuation Left: 0 Continuation Right:0

GGCGCCAACAACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGAT........................................................................................................................................................  .  NC_013198/594465‑594623
.......................................................................................................................................................CTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGAG  .  NC_013198/596210‑596358
                                                                                                                                                                                                                                                                                                                        
tGCGCCAACAACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCC                                                                                                                                                                  <  1:566511/150‑1
GGCGCCAACAACAGCAAAAATGACGTCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCC                                                                                                                                                                  <  1:488092/151‑1
 GCGCCAACAACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCT                                                                                                                                                                 <  1:175942/151‑1
     CAACAACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTTCTTTCCAAAATAAACTATCCAGACCCATCTACGCAAAAAACTGCTACTTGGCTAGTTCGTGCCTTttt                                                                                                                                                             >  2:765321/1‑148
         AACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATC                                                                                                                                                         <  2:318193/151‑1
              CAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACT                                                                                                                                                    <  1:116681/151‑1
              CAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACT                                                                                                                                                    <  2:412045/151‑1
                          CTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCC                                                                                                                                       <  2:486811/151‑1
                              TAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CC                                                                                                                                 <  2:741948/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTGGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  2:19914/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:375108/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:662225/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:295583/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:274550/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  2:731845/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:740619/151‑1
                                     TGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  1:815403/151‑1
                                     TGATCATTTTGATTCACGAGTTGGGTTTCATTGCGCGACATCGCGGG.TTCCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAACAAGCTGCTTCTTGGTTAGTTGGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAT                                                                                                                          <  2:697760/151‑1
                                      GATCATTTTTGTTCACACTGTGGGTCTCAGTGCGCAAGATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAAAACATTCTACGCAAAAGGCCGCTACTTGGCTTGTTCGTGCCTTGTTGATCAAACTTGCGAATAA.GCCA.A.CCTCTAAATC                                                                                                                         <  2:428779/151‑1
                                      GATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATC                                                                                                                         <  1:224681/151‑1
                                      GATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATC                                                                                                                         <  2:219905/151‑1
                                      GATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATC                                                                                                                         <  2:470346/151‑1
                                               GGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGGGTTTCTTTTCCAAAAAAAA.TATTCAGACCACTTTACGCCCAAAGCTGCTTCTTTGGTTGTTTTCGTCTTGTTGATCAAAATTTTTAATAAAACCA.C.CCTTTAA.TCAACACATTA                                                                                                                >  2:675765/1‑151
                                                GTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGGGTTTCTTTTCCAAAAAAAA.AATACCGACCATTCTACGCAAAAAGCTGCTCCTTGGCTAGTTTGTGCCTTGTTGTTTAAAATTTTTCATAA.AACACA.CCTTTAAA.CAAACCAATAA                                                                                                               >  2:725033/1‑151
                                                     CGAGGTGGGTTTCAGTGCGCGACATGGCGGGGTTTCTTTTCCAAAAAAAA.TATCCAGACCCTTCTACCCAAAAAACTGCTACTTTGCTAGTTTGTGGCTTGTTTATTCAACTTTCTAATAA.ACCA.AACCTTTAAATAAAGC.ATTAAAAAAa                                                                                                          >  1:184486/1‑150
                                                     CGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAAC                                                                                                          <  2:165952/151‑1
                                                           GGGTTTCAGTGCGCGACATGGCGGG.GTTTCTTTCCAAAAAAAAATATCCAGACCAATTTTCGCAAAAAACTGCTACTTGGCTAGTTTGTGCCTTTTTGATCAAACATTTGAATAA.AACA.A.CCCTTAAATTAAAACATTAAAAAACatccca                                                                                                    >  1:649879/1‑145
                                                             GTTTCAGTGCGCGACATGGCGGGGTTTCTTTTCCAAAAAAAA.TATCCAGACCCTTTTTCGCAAAAAACTGCTACTTTGGTAGTTCGTGCCTTGTTGTTCAAAATTTTGAATAA.GCCA.A.CCTTTAAATCCAACCCTTAAAAAAaatcccaaa                                                                                                  >  1:412701/1‑142
                                                             GTTTCAGTGCGCGACATGGCGGGGTTTCTTTTCCAAAA.AAACAATCCAGACCATTCTACGCAAAAAACTGCTCCTTTGCTAGTTTGGGCCTTGTTGATCAAAATTTCGAATAA.ACCA.A.CCCTTAAAAAAAGCCACTAAAAAAACTCGCAca                                                                                                  >  1:428459/1‑149
                                                                        CGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCG                                                                                       <  1:936265/151‑1
                                                                              GGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTG                                                                                 <  2:1811/151‑1
                                                                                 gtG.TTTCCTTTCCAAAATAAACTAGCCGTACCATCCTACTCAAAAATGCCCTCCTTGGTTTTTTCGTGCTTTGTTGATCAACCTTTAGAAAAC.GCCA.A.CTTTTAAACCAAGCCATTAAAAAACCTCGCAACCACGTCAAGCGCATTTGCGA                                                                              <  2:363984/149‑1
                                                                                 GGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGA                                                                              <  1:380358/151‑1
                                                                                 GGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGA                                                                              <  1:790443/151‑1
                                                                                 GGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGA                                                                              <  1:188216/151‑1
                                                                                 GGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGA                                                                              <  2:141774/151‑1
                                                                                     TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGC                                                                           <  1:361649/151‑1
                                                                                      TTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCA                                                                          <  1:762037/151‑1
                                                                                                AAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAG                                                                <  2:472063/151‑1
                                                                                                    AAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCAT                                                            >  1:493487/1‑151
                                                                                                    AAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCAT                                                            >  1:224101/1‑151
                                                                                                    AAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCAT                                                            >  1:175121/1‑151
                                                                                                        tacccggccctaTCTACGCAAAAGGCTGAGACTCGGCCAGTTCGTGCCTTGTTAAGCACACTTACAAATAA.GCTA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAGCACGTCACGGGCATTTGCGAGGCAGGTTCGTTAGTCATTTTC                                                        <  2:738277/139‑1
                                                                                                        TATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTC                                                        <  2:597398/151‑1
                                                                                                        TATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTC                                                        <  2:986112/151‑1
                                                                                                         ATCCAGACCATTCTACGCAACAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  2:984319/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  1:464746/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  2:374596/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  1:447524/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  2:486201/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  1:260796/1‑151
                                                                                                         ATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCA                                                       >  2:224206/1‑151
                                                                                                             AGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTAT                                                   >  2:582934/1‑151
                                                                                                              GACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATT                                                  >  2:841582/1‑151
                                                                                                                CCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAA                                                >  1:624374/1‑151
                                                                                                                  ATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATT                                              >  2:604199/1‑151
                                                                                                                  ATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATT                                              >  2:7738/1‑151
                                                                                                                  ATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGAATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATT                                              >  1:229754/1‑151
                                                                                                                   tttTACGCAAAAAGCTGCTACTGGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAAGCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  1:216236/148‑1
                                                                                                                   taCTACGCAAAAAGTTGCTGCTGTGTTAGTTCGTGCCTTTTTGATCAAACTTTCGAATAA.GCCA.C.CCTTTAAATCAAGCCATTAAAAAACCTCGCTAACCCGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  2:741317/149‑1
                                                                                                                   TTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  1:55303/151‑1
                                                                                                                   TTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  1:162453/151‑1
                                                                                                                   TTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  1:539232/151‑1
                                                                                                                   TTCTACGCAAAAAGCTCCTCCTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCAAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  2:89830/151‑1
                                                                                                                   TTCGACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTC                                             <  1:514971/151‑1
                                                                                                                        CGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGC                                        <  1:27422/151‑1
                                                                                                                              AAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAG                                  <  2:115631/151‑1
                                                                                                                              AAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAG                                  <  2:412560/151‑1
                                                                                                                                    CTACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAG                            <  1:248483/151‑1
                                                                                                                                     TACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGT                           <  1:675998/151‑1
                                                                                                                                     TACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGT                           <  1:442472/151‑1
                                                                                                                                     TACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTAGAATAA.GCAA.A.ACTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCACACGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTAATAGCGCAAGa                           >  2:217511/1‑150
                                                                                                                                      tCTTGGCTTGTCTGTGCTTTTTTCACCAAGCTTTGGAACAC.GCCA.T.CATTTAATGCAAGCCCTTAAAAAACCTCGCAAACTCTTCAAGCGCCTTTGCGGGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCCTAGCGTAAGTT                          <  2:320387/150‑1
                                                                                                                                      tCTTGGCTAGTTGGGGCTTTGTTGATCAAATTTTCGAATAA.GCCA.A.CCTTAAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  2:300020/150‑1
                                                                                                                                      atTTGGCAAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  2:455718/149‑1
                                                                                                                                      acttggaaggtgCGTGCCTTGTTGATCAATCTTTCGAATAA.GCCA.T.CCTTTAAATCAGGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAAATCTGAGCTCATAGCGTAAGTT                          <  2:854777/139‑1
                                                                                                                                      acgTGGCTAGTTAGTCCCCTGTTCACCACACTTTCGAATAA.GCCA.T.CCTTTAAAGCAAGCCATTAAAAAACCTCGCAAACTCGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  1:670793/148‑1
                                                                                                                                      ACTTGGCTAGTTCGTGCCTTGTTGATCAACCTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  2:9033/151‑1
                                                                                                                                      ACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  2:962183/151‑1
                                                                                                                                      ACTTGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTT                          <  1:788950/151‑1
                                                                                                                                         TGGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGT                       >  1:775828/1‑151
                                                                                                                                          GGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTC                      >  2:950749/1‑151
                                                                                                                                          GGCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTC                      >  1:16784/1‑151
                                                                                                                                           GCTAGTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCC                     <  1:101586/151‑1
                                                                                                                                               GTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATA                 >  2:49376/1‑151
                                                                                                                                               GTTCGTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATA                 >  1:729806/1‑151
                                                                                                                                                   GTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAA             <  2:851728/151‑1
                                                                                                                                                   GTGCCTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAA             >  2:423857/1‑151
                                                                                                                                                         TGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCG       >  2:286897/1‑151
                                                                                                                                                             GATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGA   >  1:331102/1‑151
                                                                                                                                                              ATCAAACTTTCGAATAA.GCCA.G.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGAG  <  1:862291/151‑1
                                                                                                                                                              ATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGAG  <  2:464605/151‑1
                                                                                                                                                              ATCAAACTTTCGAAAAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTGTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGAG  <  1:81195/151‑1
                                                                                                                                                                                                                                                                                                                        
GGCGCCAACAACAGCAAAAATGACGCCTTTTAGTTTCTGATCATTTTGGTTCACGAGGTGGGTTTCAGTGCGCGACATGGCGGG.TTTCCTTTCCAAAATAAACTATCCAGACCATTCTACGCAAAAAGCTGCTACTTGGCTAGTTCGTGCCTTGTTGAT........................................................................................................................................................  .  NC_013198/594465‑594623
.......................................................................................................................................................CTTGTTGATCAAACTTTCGAATAA.GCCA.A.CCTTTAAATCAAGCCATTAAAAAACCTCGCAAACACGTCAAGCGCATTTGCGAGGCAGGTTCGTTAGTCATTTTCAGTATTAATTCTGAGCTCATAGCGTAAGTTGGTCCGATAGAAATGGCCGAGGAG  .  NC_013198/596210‑596358

Base quality scores:  ATCG  < 3 ≤  ATCG  < 7 ≤  ATCG  < 14 ≤  ATCG  < 31 ≤  ATCG  < 41 ≤  ATCG