New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 2406720 (0.000)97 (1.148) 39/292 0.5 coding (716/759 nt) LGG_00234 hypothetical protein
?NC_013198 241548 = 0 (0.000)intergenic (+21/‑25) is8/LGG_00237 transposase IS4 family protein/hypothetical protein
Continuation Left: 0 Continuation Right:0

TCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAGAAACTGTTTGAGGTCTTTGAAAGACGCTTGAATTTCCGGTAAAATATGTGAAAAAAGGACTTCATTATGACTGATTATCCAAGCAATATCACTCGTGACCAATTTGAATTGATTCGCGTTGACCTTGAGACGTTTCGCAAGCGTACATG  .  NC_013198/240523‑240822
                                                                                                                                                      |                                                                                                                                                      
tCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAt                                                                                                                                                       <  2:847169‑M1/151‑2
tCTATTTCCGGCAGGCAGTCATCTTGGCGGGGGTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGGAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGGTTTCATTTGTGATTGCCCAAGGTGCTAAt                                                                                                                                                       >  1:94177‑M1/1‑150
  tATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTTCTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcc                                                                                                                                                     <  2:969743‑M1/151‑4
  tATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcc                                                                                                                                                     <  1:747482‑M1/151‑4
  tATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcc                                                                                                                                                     <  2:746885‑M1/151‑4
  tATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcc                                                                                                                                                     <  1:26360‑M1/151‑4
  tATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcc                                                                                                                                                     <  1:197147‑M1/151‑4
   aTTTCCGGCAGGCAGTCATCTTGGCGGGGTTTTTTTGTACTTTTTGGCGATGGCATTATTCCCGCTCATCATGGGTAATGCGGTTGCTGCCTTTGCCGGCATTTCCGCGGGCGTTGGGGTTTCCCTTT.TTATTGCCCAAGGGGGTAAtccc                                                                                                                                                    >  2:341629‑M1/1‑147
    tttCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAGtcctg                                                                                                                                                   <  2:832907‑M1/151‑6
                 gTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGGAATGCGTTTGCTGCCTTTGCCGTCATTACGGGGG.CGATTGGGATTCCATTTTTGATTTCCCCAGGGGCTAAacctgcgaacgttgcggc                                                                                                                                      >  2:913402‑M1/1‑133
                             gggTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgac                                                                                                                          >  1:385315‑M1/1‑121
                                agattTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttc                                                                                                                       <  2:751539‑M1/149‑34
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttcct                                                                                                                     >  1:751772‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:26400‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:16749‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:147647‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  1:958909‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  1:656370‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:934223‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:799364‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  2:844143‑M1/1‑116
                                  aTTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccg                                                                                                                     >  1:200163‑M1/1‑116
                                   ttttGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccgg                                                                                                                    >  2:736014‑M1/1‑115
                                    tttGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggt                                                                                                                   >  2:591720‑M1/1‑114
                                    tttGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggt                                                                                                                   <  2:618937‑M1/151‑38
                                     ttGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggtt                                                                                                                  <  1:440755‑M1/151‑39
                                     ttGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggtt                                                                                                                  <  1:772676‑M1/151‑39
                                       gTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttat                                                                                                                >  1:612448‑M1/1‑111
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCCAGGTGCTCAtcctgcgatcgttgcggccattgggatgacttccggttattgagg                                                                                                           >  2:348110‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  1:976805‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  1:964815‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  2:467717‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  2:127922‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  2:693317‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  2:705058‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  1:278239‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  2:943064‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcgg                                                                                                           >  1:673024‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccgggtattgcgg                                                                                                           >  1:348567‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGGGCTAAtcctgcgatcgttgcggccattgggatgacctccggttattgcgg                                                                                                           >  1:659770‑M1/1‑106
                                            gtgtgGCGATGGCATTATTCACGACCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGACCAAGGCGCTAAtccggcgatagttgcggccattaggatgacttccggttattgcgg                                                                                                           >  2:106811‑M1/1‑106
                                               tgGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcac                                                                                                        <  2:342229‑M1/151‑49
                                                    aTGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttat                                                                                                   <  1:495168‑M1/151‑54
                                                      ggCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattg                                                                                                 >  2:746089‑M1/1‑96
                                                      ggCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattg                                                                                                 <  1:943329‑M1/151‑56
                                                      ggCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattg                                                                                                 <  2:198671‑M1/151‑56
                                                       gCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattga                                                                                                >  1:900492‑M1/1‑95
                                                       gCATCATTCACGATCATCATGGGAAAGGCGATTGCTGCCGTTGCCGCCATTACGGAGA.CGATTGGGATTGTAATTGGGACTGTCCACGGTGCTTAtttttcgaccgttgtggccattgggagggcttccggttattgcggcaccttattta                                                                                                >  2:252908‑M1/1‑95
                                                        cATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgac                                                                                               <  1:592628‑M1/151‑58
                                                         attattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacc                                                                                              <  1:746322‑M1/151‑59
                                                         attattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacc                                                                                              <  1:721011‑M1/151‑59
                                                         attattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacc                                                                                              <  2:335261‑M1/151‑59
                                                         attattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacc                                                                                              <  2:326180‑M1/151‑59
                                                         attattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacc                                                                                              <  1:656377‑M1/151‑59
                                                           tattCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccc                                                                                            <  2:95482‑M1/151‑61
                                                            attCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccct                                                                                           >  1:117834‑M1/1‑90
                                                                 cGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggc                                                                                      <  1:591873‑M1/151‑67
                                                                   atcatcATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcag                                                                                    <  2:602064‑M1/151‑69
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggccgcg                                                                                  >  2:507649‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  1:859520‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  2:574324‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  2:421620‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  2:928666‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  1:14825‑M1/1‑81
                                                                     catcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcg                                                                                  >  2:261315‑M1/1‑81
                                                                      atcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcga                                                                                 >  2:776953‑M1/1‑80
                                                                      atcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcga                                                                                 >  2:119092‑M1/1‑80
                                                                      atcatGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcga                                                                                 >  1:891722‑M1/1‑80
                                                                           gggTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttc                                                                            >  1:389017‑M1/1‑75
                                                                           gggTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttc                                                                            >  1:890765‑M1/1‑75
                                                                              tAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaat                                                                         <  2:389004‑M1/151‑80
                                                                              tAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaat                                                                         <  2:58342‑M1/151‑80
                                                                                ttgctgtggttgcctttgccgttTTTACTGTGG.CGATTGGGTGTCTATTTGGTATTGCCCAGGGTTTTATtcctgcgttcgttgcggccattggtatgtcttccggttattgcggcaccttattgacccctctggcagctaattttaatag                                                                       <  2:114205‑M1/141‑82
                                                                                     tttGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttac                                                                  <  2:715862‑M1/151‑87
                                                                                                     tCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctgga                                                  >  2:785993‑M1/1‑49
                                                                                                      cATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaa                                                 >  1:350809‑M1/1‑48
                                                                                                                g.cgATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatc                                       <  1:198456‑M1/151‑114
                                                                                                                g.cgATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatc                                       >  1:908964‑M1/1‑38
                                                                                                                    aTTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccat                                    >  1:896329‑M1/1‑35
                                                                                                                        ggATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatggcttccggttattgcggcaccttattgacccctatggaagcgaatttcaatagtttaccggttgcgttgctggaaatggaagctccattggg                                >  2:910687‑M1/1‑31
                                                                                                                        ggATTCCATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattggg                                >  1:364560‑M1/1‑31
                                                                                                                             ccATTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtca                           >  2:892568‑M1/1‑26
                                                                                                                               aTTTGTGATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcatt                         >  2:882996‑M1/1‑24
                                                                                                                                   gtgATTGCCCAAGGTGCTAAtcctgctatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagc                     <  2:346583‑M1/151‑132
                                                                                                                                   gtgATTGCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagc                     <  1:542795‑M1/151‑132
                                                                                                                                         gCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcagg               >  1:675171‑M1/1‑14
                                                                                                                                         gCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcagg               >  2:177394‑M1/1‑14
                                                                                                                                         gCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcagg               >  2:931593‑M1/1‑14
                                                                                                                                         gCCCAAGGTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcagg               >  1:241800‑M1/1‑14
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagccgcaggcacccat        >  2:191107‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccat        >  2:972946‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccat        >  2:707953‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccat        >  1:960326‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccat        >  2:361876‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccat        >  2:442763‑M1/1‑7
                                                                                                                                                gTGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccac        >  1:759067‑M1/1‑7
                                                                                                                                                 tGCTAAtcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccatc       >  1:752869‑M1/1‑6
                                                                                                                                                      atcctgcgatcgttgcggccattgggatgacttccggttattgcggcaccttattgacccctatggcagcgaatttcaatagtttaccggttgcgttgctggaaatggaagatccattgggcgtcattaagcagcaggcacccatcgcgat  <  1:221652‑M1/151‑151
                                                                                                                                                      |                                                                                                                                                      
TCTATTTCCGGCAGGCAGTCATCTTGGCGGGGTTATTTTGTACTGTGTGGCGATGGCATTATTCACGATCATCATGGGTAATGCGTTTGCTGCCTTTGCCGTCATTACGGCGG.CGATTGGGATTCCATTTGTGATTGCCCAAGGTGCTAAGAAACTGTTTGAGGTCTTTGAAAGACGCTTGAATTTCCGGTAAAATATGTGAAAAAAGGACTTCATTATGACTGATTATCCAAGCAATATCACTCGTGACCAATTTGAATTGATTCGCGTTGACCTTGAGACGTTTCGCAAGCGTACATG  .  NC_013198/240523‑240822

Base quality scores:  ATCG  < 3 ≤  ATCG  < 10 ≤  ATCG  < 24 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG