New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 2406720 (0.000)97 (1.148) 39/292 0.5 coding (716/759 nt) LGG_00234 hypothetical protein
?NC_013198 241548 = 0 (0.000)intergenic (+21/‑25) is8/LGG_00237 transposase IS4 family protein/hypothetical protein
Continuation Left: 0 Continuation Right:0

GGTCGTGGAACGTAGTTTCAGTTGGTTAACCAACTGGCGACGGCTTTTGTTCAATTGCGAACGCAAGTTAAATACCAGTAAAGTCATGGTTGCTATGGCCTTTATAGGGATCCTGCTTGCTCGTCAATAGAGACCTCAAACAGCTTCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAT  .  NC_013198/241398‑241697
                                                                                                                                                      |                                                                                                                                                     
tctatttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaat                                                                                                                                                       <  2:847169‑M2/1‑1
tctatttccggcaggcagtcatcttggcgggggtattttgtactgtgtggcgatggcattattcacgatcatcatggggaatgcgtttgctgcctttgccgtcattacggcggcgattggggtttcatttgtgattgcccaaggtgctaat                                                                                                                                                       >  1:94177‑M2/151‑151
  tatttccggcaggcagtcatcttggcggggttattttgttctgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTcc                                                                                                                                                     <  2:969743‑M2/3‑1
  tatttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTcc                                                                                                                                                     <  1:747482‑M2/3‑1
  tatttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTcc                                                                                                                                                     <  2:746885‑M2/3‑1
  tatttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTcc                                                                                                                                                     <  1:26360‑M2/3‑1
  tatttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTcc                                                                                                                                                     <  1:197147‑M2/3‑1
   atttccggcaggcagtcatcttggcggggtttttttgtactttttggcgatggcattattcccgctcatcatgggtaatgcggttgctgcctttgccggcatttccgcgggcgttggggtttccctttttattgcccaagggggtaatccc                                                                                                                                                    >  2:341629‑M2/148‑150
    tttccggcaggcagtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctagTCCTg                                                                                                                                                   <  2:832907‑M2/5‑1
                 gtcatcttggcggggttattttgtactgtgtggcgatggcattattcacgatcatcatggggaatgcgtttgctgcctttgccgtcattacgggggcgattgggattccatttttgatttccccaggggctaaACCTGCGAACGTTGCGGc                                                                                                                                      >  2:913402‑M2/134‑151
                             gggttattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGAc                                                                                                                          >  1:385315‑M2/122‑151
                                agattttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTc                                                                                                                       <  2:751539‑M2/33‑1
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTtcct                                                                                                                     >  1:751772‑M2/117‑150
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:26400‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:16749‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:147647‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  1:958909‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  1:656370‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:934223‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:799364‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  2:844143‑M2/117‑151
                                  attttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCg                                                                                                                     >  1:200163‑M2/117‑151
                                   ttttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCgg                                                                                                                    >  2:736014‑M2/116‑151
                                    tttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGt                                                                                                                   >  2:591720‑M2/115‑151
                                    tttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGt                                                                                                                   <  2:618937‑M2/37‑1
                                     ttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGtt                                                                                                                  <  1:440755‑M2/38‑1
                                     ttgtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGtt                                                                                                                  <  1:772676‑M2/38‑1
                                       gtactgtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTAt                                                                                                                >  1:612448‑M2/112‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgccccaggtgctcaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTattgagg                                                                                                           >  2:348110‑M2/107‑148
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  1:976805‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  1:964815‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:467717‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:127922‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:693317‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:705058‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  1:278239‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:943064‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCgg                                                                                                           >  1:673024‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGGTATTGCgg                                                                                                           >  1:348567‑M2/107‑151
                                            gtgtggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggggctaaTCCTGCGATCGTTGCGGCCATTGGGATGACCTCCGGTTATTGCgg                                                                                                           >  1:659770‑M2/107‑151
                                            gtgtggcgatggcattattcacgaccatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgaccaaggcgctaaTCCGGCGATAGTTGCGGCCATTAGGATGACTTCCGGTTATTGCgg                                                                                                           >  2:106811‑M2/107‑151
                                               tggcgatggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCAc                                                                                                        <  2:342229‑M2/48‑1
                                                    atggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTAt                                                                                                   <  1:495168‑M2/53‑1
                                                      ggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTg                                                                                                 >  2:746089‑M2/97‑151
                                                      ggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTg                                                                                                 <  1:943329‑M2/55‑1
                                                      ggcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTg                                                                                                 <  2:198671‑M2/55‑1
                                                       gcattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGa                                                                                                >  1:900492‑M2/96‑151
                                                       gcatcattcacgatcatcatgggaaaggcgattgctgccgttgccgccattacggagacgattgggattgtaattgggactgtccacggtgcttaTTTTTCGACCGTTGTGGCCATTGGGAGGGCTTCCGGTTATTGCGGCACCTtattta                                                                                                >  2:252908‑M2/96‑149
                                                        cattattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAc                                                                                               <  1:592628‑M2/57‑1
                                                         attattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcc                                                                                              <  1:746322‑M2/58‑1
                                                         attattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcc                                                                                              <  1:721011‑M2/58‑1
                                                         attattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcc                                                                                              <  2:335261‑M2/58‑1
                                                         attattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcc                                                                                              <  2:326180‑M2/58‑1
                                                         attattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcc                                                                                              <  1:656377‑M2/58‑1
                                                           tattcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGAcccc                                                                                            <  2:95482‑M2/60‑1
                                                            attcacgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCt                                                                                           >  1:117834‑M2/91‑151
                                                                 cgatcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGc                                                                                      <  1:591873‑M2/66‑1
                                                                   atcatcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAg                                                                                    <  2:602064‑M2/68‑1
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCCGCg                                                                                  >  2:507649‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  1:859520‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  2:574324‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  2:421620‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  2:928666‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  1:14825‑M2/82‑151
                                                                     catcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCg                                                                                  >  2:261315‑M2/82‑151
                                                                      atcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGa                                                                                 >  2:776953‑M2/81‑151
                                                                      atcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGa                                                                                 >  2:119092‑M2/81‑151
                                                                      atcatgggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGa                                                                                 >  1:891722‑M2/81‑151
                                                                           gggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTc                                                                            >  1:389017‑M2/76‑151
                                                                           gggtaatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTc                                                                            >  1:890765‑M2/76‑151
                                                                              taatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAAt                                                                         <  2:389004‑M2/79‑1
                                                                              taatgcgtttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAAt                                                                         <  2:58342‑M2/79‑1
                                                                                ttgctgtggttgcctttgccgtttttactgtggcgattgggtgtctatttggtattgcccagggttttatTCCTGCGTTCGTTGCGGCCATTGGTATGTCTTCCGGTTATTGCGGCACCTTATTGACCCCTCTGGCAGCTAATTTTAATAg                                                                       <  2:114205‑M2/81‑1
                                                                                     tttgctgcctttgccgtcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTAc                                                                  <  2:715862‑M2/86‑1
                                                                                                     tcattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGa                                                  >  2:785993‑M2/50‑151
                                                                                                      cattacggcggcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGaa                                                 >  1:350809‑M2/49‑151
                                                                                                                gcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATc                                       <  1:198456‑M2/113‑1
                                                                                                                gcgattgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATc                                       >  1:908964‑M2/39‑151
                                                                                                                   attgggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCAt                                    >  1:896329‑M2/36‑151
                                                                                                                       ggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGGCTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGAAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGCTCCATTggg                                >  2:910687‑M2/32‑151
                                                                                                                       ggattccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTggg                                >  1:364560‑M2/32‑151
                                                                                                                            ccatttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCa                           >  2:892568‑M2/27‑151
                                                                                                                              atttgtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCAtt                         >  2:882996‑M2/25‑151
                                                                                                                                  gtgattgcccaaggtgctaaTCCTGCTATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAagc                     <  2:346583‑M2/131‑1
                                                                                                                                  gtgattgcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAagc                     <  1:542795‑M2/131‑1
                                                                                                                                        gcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAgg               >  1:675171‑M2/15‑151
                                                                                                                                        gcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAgg               >  2:177394‑M2/15‑151
                                                                                                                                        gcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAgg               >  2:931593‑M2/15‑151
                                                                                                                                        gcccaaggtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAgg               >  1:241800‑M2/15‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCCGCAGGCACCCAt        >  2:191107‑M2/8‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCcac        >  1:759067‑M2/8‑150
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAt        >  2:972946‑M2/8‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAt        >  2:707953‑M2/8‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAt        >  1:960326‑M2/8‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAt        >  2:361876‑M2/8‑151
                                                                                                                                               gtgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCAt        >  2:442763‑M2/8‑151
                                                                                                                                                tgctaaTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATc       >  1:752869‑M2/7‑151
                                                                                                                                                     aTCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAt  <  1:221652‑M2/150‑1
                                                                                                                                                      |                                                                                                                                                     
GGTCGTGGAACGTAGTTTCAGTTGGTTAACCAACTGGCGACGGCTTTTGTTCAATTGCGAACGCAAGTTAAATACCAGTAAAGTCATGGTTGCTATGGCCTTTATAGGGATCCTGCTTGCTCGTCAATAGAGACCTCAAACAGCTTCTAATCCTGCGATCGTTGCGGCCATTGGGATGACTTCCGGTTATTGCGGCACCTTATTGACCCCTATGGCAGCGAATTTCAATAGTTTACCGGTTGCGTTGCTGGAAATGGAAGATCCATTGGGCGTCATTAAGCAGCAGGCACCCATCGCGAT  .  NC_013198/241398‑241697

Base quality scores:  ATCG  < 3 ≤  ATCG  < 10 ≤  ATCG  < 24 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG