Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_013198 1,038,046 Δ860 bp [LGG_01023]–is36 [LGG_01023], is35, is36

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_013198 1038046–1038901 1038905 5–860 66 [0] [0] 66 [LGG_01023]–is36 [LGG_01023], is35, is36

New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 10380450 (0.000)64 (0.745) 39/290 0.4 coding (872/978 nt) LGG_01023 adenine specific DNA methylase Mod
?NC_013198 1038906 = 0 (0.000)intergenic (+13/‑238) is36/LGG_01026 transposase IS4 family protein/type III restriction‑modification system methylation subunit
Continuation Left: 0 Continuation Right:0

ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAG......................................................................................................................................................  .  NC_013198/1037891‑1038045
......................................................................................................................................................CTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  .  NC_013198/1038906‑1039055
                                                                                                                                                                                                                                                                                                                 
gagacagACCATACATTGGCTTATGCTAAGAACAGAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACC                                                                                                                                                            <  2:422306/144‑1
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  2:180918/1‑151
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  1:408023/1‑151
  GTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTA                                                                                                                                                          >  2:290349/1‑151
      AACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGG                                                                                                                                                      <  1:1242412/151‑1
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTCGGAGCCCAAACCctgtctc                                                                                                                                                     >  1:422295/1‑144
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     >  1:47680/1‑151
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     >  1:465228/1‑151
       ACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGC                                                                                                                                                     >  1:419718/1‑151
          ATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAAC                                                                                                                                                  >  1:371019/1‑151
            ACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACAT                                                                                                                                                <  2:465239/151‑1
            ACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACAT                                                                                                                                                >  1:125114/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTCCGA                                                                                                                                           >  1:864556/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           >  2:929166/1‑151
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           <  2:1078971/151‑1
                 GGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGA                                                                                                                                           >  1:1079339/1‑151
                      ATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAA                                                                                                                                      >  2:218262/1‑151
                         CTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATAT                                                                                                                                   <  1:190653/151‑1
                            AGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACTACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTAC                                                                                                                                <  2:1151721/151‑1
                             GAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACT                                                                                                                               >  2:908581/1‑151
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              <  2:638563/151‑1
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTG                                                                                                                              <  1:285930/151‑1
                              AACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGAAACATAACGATCTATAATTACTG                                                                                                                              >  2:1129083/1‑151
                                    AATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCA                                                                                                                        >  2:263374/1‑151
                                                     CTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTT                                                                                                       >  2:901080/1‑151
                                                                   CATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCAACCTAAAAATGG                                                                                         >  2:835224/1‑151
                                                                          GGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGA                                                                                  >  1:1086399/1‑151
                                                                          GGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGA                                                                                  >  1:970138/1‑151
                                                                            ATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATG                                                                                >  2:322528/1‑151
                                                                              AATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGT                                                                              >  1:984986/1‑151
                                                                               ATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTC                                                                             >  1:408974/1‑151
                                                                               ATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTC                                                                             >  2:105210/1‑151
                                                                                   AAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAA                                                                         >  1:1032727/1‑151
                                                                                   AAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAA                                                                         >  2:524372/1‑151
                                                                                     ACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGA                                                                       <  1:322519/151‑1
                                                                                      CTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGAT                                                                      >  2:1221787/1‑151
                                                                                      CTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGAT                                                                      >  1:345674/1‑151
                                                                                        ATTCAAATCCGGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATAC                                                                    >  2:133614/1‑151
                                                                                            AAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATT                                                                <  2:408984/151‑1
                                                                                            AAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATT                                                                <  1:908897/151‑1
                                                                                             AATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTA                                                               >  2:849344/1‑151
                                                                                                  AGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAA                                                          <  2:864239/151‑1
                                                                                                          ACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAA                                                  >  2:1160621/1‑151
                                                                                                           CTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAA                                                 >  1:842150/1‑151
                                                                                                             gacagGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               <  1:419708/146‑1
                                                                                                             CAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               <  2:352880/151‑1
                                                                                                             CAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATC                                               >  1:839192/1‑151
                                                                                                                  GGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCctgtc                                          >  2:419719/1‑146
                                                                                                                     GCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAG                                       >  1:846602/1‑151
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  2:1190418/1‑151
                                                                                                                       GTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTT                                     >  2:707708/1‑151
                                                                                                                            GAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTT                                <  1:915724/151‑1
                                                                                                                            GAGCAGGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTT                                >  1:812207/1‑151
                                                                                                                                 GGAGATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGC                           >  1:1025491/1‑151
                                                                                                                                    GATGTTAGGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTG                        >  1:314618/1‑151
                                                                                                                                           GGAGCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTC                 <  1:105199/151‑1
                                                                                                                                              GCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGG              >  2:253623/1‑151
                                                                                                                                              GCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGG              >  2:349138/1‑151
                                                                                                                                              GCCCAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGG              >  1:965562/1‑151
                                                                                                                                                 agAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAAT           <  1:1120901/149‑1
                                                                                                                                                 CAAACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAAT           <  2:408033/151‑1
                                                                                                                                                   AACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCt         >  2:1120534/1‑150
                                                                                                                                                   AACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCA         >  2:926310/1‑151
                                                                                                                                                   AACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCA         >  1:1209859/1‑151
                                                                                                                                                   AACCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCA         >  1:1216292/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATa       >  2:247659/1‑150
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  2:752440/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  1:640852/1‑151
                                                                                                                                                     CCTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATAAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATC       >  2:1163178/1‑151
                                                                                                                                                          GGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  >  1:729046/1‑151
                                                                                                                                                          GGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  >  1:53217/1‑151
                                                                                                                                                                                                                                                                                                                 
ATGTATAACCATACATTGGCTTATGCTAAGAACATAAATAAATTGAACCCGTTCTTTTTAAAGAGAACATCAAAGGATAATATAAACTATTCAAATCCAGACAACGACTCAAATGGAGCGTGGAGAGCAGGAGATGTTAGGAGCCCAAACCTAAG......................................................................................................................................................  .  NC_013198/1037891‑1038045
......................................................................................................................................................CTAAGGGCAACATTACGATATAATATTACTGCTCCCAATGGAAAGACCATTTTTCCACCTAAAAATGGGTGGAGATGGTCTAAAGATACAATTAATGAAAAAATCAAATCTGGAGAAGTTGTTTTTAAGCCTGATAATTCTGGAATCATCAGAAA  .  NC_013198/1038906‑1039055

Base quality scores:  ATCG  < 3 ≤  ATCG  < 25 ≤  ATCG  < 31 ≤  ATCG  < 35 ≤  ATCG  < 41 ≤  ATCG