New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 1058951 =66 (0.752)30 (0.342) 13/296 2.5 coding (53/183 nt) LGG_01046 hypothetical protein
?NC_013198 = 2898115 109 (1.226)coding (225/237 nt) LGG_02835 hypothetical protein
Continuation Left: 0 Continuation Right:0

CTTCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAGCCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGGCCTGGGTTTGGCCATTGCGACCAAGGTCCTTACACGCAGATCCCTGCGCCGGTGAACGCGTTATGGTGA......................................................................................................  .  NC_013198/1059101‑1058951
.....................................................................................................................................................GAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGACCAAGGTCCTTATGTGCAGGTTTCTGGGC  .  NC_013198/2898115‑2898014
                                                                                                                                                                                                                                                             
CTTCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAGCCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGGCCTGGGTTTGGCCATTGCGACCAAGGTCCTTACACGCAGATCCCTGCGCCGGTGAACGCGTTATGGTGA                                                                                                        >  1:1117231/1‑151
                                          cgcttagggatCGGAGTGTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTT                                                              >  1:1130243/12‑151
                                             ttagggatCGGAGTTTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGG                                                           <  2:516794/143‑1
                                              aAGAGACAGGAGTGTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGC                                                          <  2:364264/150‑1
                                                    tCGGAGTGTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGcaatg                                                    <  1:998876/150‑6
                                                    tCGGAGTGTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGcaatg                                                    <  1:706795/150‑6
                                                    tCGGAGTGTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGcaatg                                                    <  1:48539/150‑6
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCctgtctctt                                                 >  1:364255/6‑142
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACC                                                 >  1:745380/6‑151
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACC                                                 >  1:161725/6‑151
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACC                                                 >  2:1104004/6‑151
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACC                                                 >  2:197518/6‑151
                                                       gagtgTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACC                                                 >  2:191255/6‑151
                                                           gTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGC                                             >  1:411250/2‑151
                                                           gTAAGTGGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGC                                             >  2:914191/2‑151
                                                                 GGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGT                                       >  2:827203/1‑151
                                                                 GGCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGT                                       >  2:1183728/1‑151
                                                                  GCCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTC                                      <  1:197506/151‑1
                                                                   CCTTGGGCGTGATGGCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGaca                                     >  1:172525/1‑148
                                                                                 GCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTC                       >  2:963039/1‑151
                                                                                 GCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTC                       <  2:33104/151‑1
                                                                                 GCCTGGGCTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTC                       >  1:93383/1‑151
                                                                                      ggcTTGGCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTAT                  >  1:998482/4‑151
                                                                                       gcTTGGCCATTGCGCCCAAGGTCCTTACGCTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATG                 <  2:133343/149‑1
                                                                                       gcTTGGCCATTGCGACCAAGGTCCTTACACTCCGGTCCCTGCGCTGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATG                 <  2:493755/149‑1
                                                                                            GCCATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAG            >  2:268726/1‑151
                                                                                               ATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAGGTT         <  1:963353/151‑1
                                                                                               ATTGCGACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAGGTT         <  2:941904/151‑1
                                                                                                    GACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAGGTTTCTGG    <  1:191244/151‑1
                                                                                                     ACCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAGGTTTCTGGG   >  2:108802/1‑151
                                                                                                      CCAAGGTCCTTACACTCCGATCCCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGCCCAAGGTCCTTATGTGCAGGTTTCTGGGC  <  1:914507/151‑1
                                                                                                                                                                                                                                                             
CTTCTGCGCCGGTGAACGCGTTATGGTGAGCGTGAGCCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGGCCTGGGTTTGGCCATTGCGACCAAGGTCCTTACACGCAGATCCCTGCGCCGGTGAACGCGTTATGGTGA......................................................................................................  .  NC_013198/1059101‑1058951
.....................................................................................................................................................GAGCGTGAACCAGCCCGGTTAGAAACCGGAGCATAAGTGGCCTTGGGCGTGATGACCGGGCTTTGGTCATTGCGACCAAGGTCCTTATGTGCAGGTTTCTGGGC  .  NC_013198/2898115‑2898014

Base quality scores:  ATCG  < 3 ≤  ATCG  < 18 ≤  ATCG  < 29 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG