Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_013198 1,877,309 Δ1,586 bp LGG_01848 LGG_01848

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_013198 1877309 1878894 1586 104 [0] [0] 104 LGG_01848 LGG_01848

New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 18773080 (0.000)98 (1.172) 48/282 0.2 intergenic (‑337/‑114) LGG_01847/LGG_01848 membrane protein/hypothetical protein
?NC_013198 1878895 = 0 (0.000)intergenic (+70/‑60) LGG_01848/tRNA‑Leu hypothetical protein/tRNA‑Leu
Continuation Left: 0 Continuation Right:0

Only 100 of 107 total aligned reads displayed.

ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTA....................................................................................................................................................  .  NC_013198/1877152‑1877308
....................................................................................................................................................CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  .  NC_013198/1878895‑1879042
                                                                                                                                                                                                                                                                                                                 
ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGC                                                                                                                                                            <  1:358203/151‑1
  CGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTT                                                                                                                                                          >  1:584791/1‑151
        GGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAA                                                                                                                                                    >  1:95905/1‑151
        GGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAA                                                                                                                                                    >  2:844716/1‑151
           CGCTTGGGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTT                                                                                                                                                 >  2:283012/1‑151
           CGCTTGGGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTT                                                                                                                                                 >  2:641154/1‑151
                gtgcTCTAGCTTATTCGCTTGACGCGGTCACCGCCGCAGAAAGCTGCGGGTAAGGACCTTAAGCGAAATGGCCCAAGCCCGGCCTTTACGCCTCAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAGATTTCTATT                                                                                                                                            >  2:920224/5‑151
                 GGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTG                                                                                                                                           >  2:403729/1‑151
                 GGTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTG                                                                                                                                           >  2:671605/1‑151
                  GTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGA                                                                                                                                          >  2:955050/1‑151
                  GTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGA                                                                                                                                          >  1:762977/1‑151
                  GTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGA                                                                                                                                          >  1:224118/1‑151
                  GTTCTAGCTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGA                                                                                                                                          >  1:1207270/1‑151
                    TCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACT                                                                                                                                        <  2:590962/151‑1
                         CTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAAT                                                                                                                                   >  1:1043634/1‑151
                         CTTATGCCCTTGACGCGCCCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAAT                                                                                                                                   >  2:911239/1‑151
                          TTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATC                                                                                                                                  <  2:387235/151‑1
                          TTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATC                                                                                                                                  <  2:675197/151‑1
                               CCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACG                                                                                                                             >  2:475808/1‑151
                               CCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACG                                                                                                                             >  1:438224/1‑151
                                    GACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTC                                                                                                                        >  1:982497/1‑151
                                            CACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATA                                                                                                                >  1:927194/1‑151
                                             cCCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATAT                                                                                                               <  2:1094682/150‑1
                                             ACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATAT                                                                                                               <  2:1034926/151‑1
                                             ACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATAT                                                                                                               <  1:671721/151‑1
                                             ACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATAT                                                                                                               <  1:430351/151‑1
                                               CGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTT                                                                                                             <  1:955364/151‑1
                                                GGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTC                                                                                                            <  1:313815/151‑1
                                                 GCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCT                                                                                                           >  2:55963/1‑151
                                                 GCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCT                                                                                                           >  2:281959/1‑151
                                                   GCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTG                                                                                                         >  1:174000/1‑151
                                                   GCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTG                                                                                                         <  1:124919/151‑1
                                                       AAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCT                                                                                                     >  2:784093/1‑151
                                                          CCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAA                                                                                                  >  2:1208663/1‑151
                                                               GTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATCATATTTCTTGTGCTTAATTAGT                                                                                             >  2:298001/1‑151
                                                                TGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTC                                                                                            >  1:110480/1‑151
                                                                TGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTC                                                                                            >  2:1254114/1‑151
                                                                TGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTC                                                                                            >  2:94283/1‑151
                                                                 GTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCA                                                                                           >  1:181326/1‑151
                                                                      GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  2:398500/1‑151
                                                                      GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  2:751255/1‑151
                                                                      GACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGG                                                                                      >  2:1013393/1‑151
                                                                        nCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  1:513305/2‑151
                                                                        CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  2:584725/1‑151
                                                                        CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  2:861688/1‑151
                                                                        CCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGC                                                                                    >  2:1103710/1‑151
                                                                          TTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCAT                                                                                  <  1:1038873/151‑1
                                                                          TTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCAT                                                                                  <  2:181338/151‑1
                                                                              GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  2:1002340/1‑151
                                                                              GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  2:264037/1‑151
                                                                              GCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCG                                                                              >  1:723747/1‑151
                                                                                GTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGA                                                                            >  1:607542/1‑151
                                                                                  AATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAAT                                                                          <  1:1254480/151‑1
                                                                                     ggccgggcttgGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATCTTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGCATTGG                                                                       >  2:539990/12‑151
                                                                                     GGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGG                                                                       >  1:893589/1‑151
                                                                                     GGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAACTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGG                                                                       >  2:839136/1‑151
                                                                                      GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  2:620027/1‑151
                                                                                      GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  1:1208698/1‑151
                                                                                      GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  2:1062308/1‑151
                                                                                      GCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGT                                                                      >  2:910631/1‑151
                                                                                       CCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTA                                                                     <  2:918652/151‑1
                                                                                           AGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACG                                                                 >  2:1190110/1‑151
                                                                                           AGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACG                                                                 >  1:947317/1‑151
                                                                                           AGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACG                                                                 >  1:862074/1‑151
                                                                                            GCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGC                                                                >  1:60965/1‑151
                                                                                               gGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCA                                                             >  1:385097/2‑151
                                                                                                  CCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGA                                                          >  2:1251829/1‑151
                                                                                                  CCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGA                                                          >  2:1240367/1‑151
                                                                                                   CATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGAT                                                         <  1:1209029/151‑1
                                                                                                    ATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATT                                                        <  1:842603/151‑1
                                                                                                       ACGCTTAAGGTC.CTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCGAGATTAAGG                                                    >  2:891443/1‑151
                                                                                                        CGCTTAAGGCCACTTACGCTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  1:1163867/151‑1
                                                                                                        CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  1:264022/151‑1
                                                                                                        CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  2:926879/151‑1
                                                                                                        CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    >  1:402568/1‑151
                                                                                                        CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  1:1090365/151‑1
                                                                                                        CGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGG                                                    <  2:723565/151‑1
                                                                                                         GCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGA                                                   >  1:1142124/1‑151
                                                                                                          CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  <  1:281945/151‑1
                                                                                                          CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  <  2:402577/151‑1
                                                                                                          CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  <  1:584876/151‑1
                                                                                                          CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  <  1:794593/151‑1
                                                                                                          CTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGAT                                                  >  1:177218/1‑151
                                                                                                            TAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCT                                                >  1:120916/1‑151
                                                                                                              acagCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTG                                              <  2:1000644/147‑1
                                                                                                              AGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTG                                              <  1:21365/151‑1
                                                                                                                  CACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGctgt                                          >  1:1000959/1‑147
                                                                                                                  CACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAG                                          >  2:291101/1‑151
                                                                                                                  CACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAG                                          >  2:959511/1‑151
                                                                                                                             CGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTC                               >  1:1106357/1‑151
                                                                                                                               GTTTCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGGGCATTTTTGCTCAT                             >  2:964977/1‑151
                                                                                                                                  TCTAAGCGCGCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGA                          <  1:641286/151‑1
                                                                                                                                           GCCGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGT                 <  2:174011/151‑1
                                                                                                                                             CGGTTCGCGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCT               <  2:712197/151‑1
                                                                                                                                                    acagTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  2:683457/147‑1
                                                                                                                                                    CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  2:526188/151‑1
                                                                                                                                                    CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCC        <  1:1104078/151‑1
                                                                                                                                                        TAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCtgt    >  1:683589/1‑148
                                                                                                                                                          GTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  >  2:1202872/1‑151
                                                                                                                                                          GTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  <  1:630931/151‑1
                                                                                                                                                                                                                                                                                                                 
ACCGCTGAGGCCGCTTGGGTTCTAGCTTATGCCCTTGACGCGCTCACCGGCGCAGAAACCTGCGTGTAAGGACCTTAAGCGTAATGGCCCAAGCCCGGCCATTACGCTTAAGGCCACTTACACTCCGGTTTCTAAGCGCGCCGGTTCGCGCTTAGTA....................................................................................................................................................  .  NC_013198/1877152‑1877308
....................................................................................................................................................CGCTTAGTAAATTTCTATTGACTTTAATCTCACGTTTTCCTATAATATTTCTTGTGCTTAATTAGTCATGCGGGCATGGCGGAATTGGTAGACGCGCAAGATTAAGGATCTTGTGAGCATTTTTGCTCATGGAAGTTCGAGTCTTCTTGCCCGCATC  .  NC_013198/1878895‑1879042

Base quality scores:  ATCG  < 3 ≤  ATCG  < 20 ≤  ATCG  < 30 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG