New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 2122110 =71 (0.843)42 (0.499) 12/284 2.5 intergenic (‑168/+326) efp/yrjD protein elongation factor P/hypothetical protein
?NC_013198 2122257 = 72 (0.810)intergenic (‑315/+179) efp/yrjD protein elongation factor P/hypothetical protein
Continuation Left: 0 Continuation Right:0

GCTGGCGGAGCGGTGGCGGGCTCAGTGGTGAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGC...................................................................................................................................................  .  NC_013198/2122265‑2122110
....................................................................................................................................................GCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCCCGA  .  NC_013198/2122257‑2122403
                                                                                                                                                                                                                                                                                                               
GCTGGCGGAGCGGTGGCGGGCTCAGTGGTGAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCC                                                                                                                                                          <  1:437645/151‑1
GCTGGCGGAGCGGTGGCGGGCTCAGTGGTGAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCC                                                                                                                                                          <  2:298065/151‑1
     gGGAGCGGTGGCGGGCTCAGTGGTGAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGC                                                                                                                                                     <  2:1056454/150‑1
                             GAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACGGCTCCGCCAGCTCTTGCTTTCTATCC                                                                                                                             >  1:491192/1‑151
                                    GTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACc                                                                                                                      >  2:632751/1‑150
                                    GTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCCCCGCCAGCTCTTGCTTTCTATCCCTGCACT                                                                                                                      >  2:481064/1‑151
                                                GTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGA                                                                                                          >  2:489891/1‑151
                                                            gcaTTAGACCAAGGCCGGGCGGCGAAACCGCGGTCTTTACGGGTTCGAAGTCGCGCCCACCCCTCTAGCTCGCCGATAAACAGCCCGAGCCACCGCGCCGCCCGACCTTCCTTTCTATCCCTGCACCCCAACAACCACACTCAACGCATCC                                                                                              >  2:1034758/4‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACCACGAGACTCAACGTATCC                                                                                              >  2:169528/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCCACGTATCC                                                                                              >  2:5720/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  1:952565/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  1:707931/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  1:550716/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  2:634769/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  2:83566/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  2:1068838/1‑151
                                                            GCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGGCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCC                                                                                              >  1:696104/1‑151
                                                             CTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCT                                                                                             >  2:1224757/1‑151
                                                                  GACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTT                                                                                        >  1:481434/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCCCTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  2:124368/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGCCCCAACGcacccctcgctg                                                                                       >  2:116319/1‑139
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCCACGTATCCTTCGTTG                                                                                       >  2:1202217/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  2:41304/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  2:632845/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  2:755030/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  2:893607/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:958953/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:837744/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:779478/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:777775/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:102128/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:1097900/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:1171301/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:1226645/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:147734/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:419703/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTG                                                                                       >  1:217211/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGCATCCTTCGTTG                                                                                       >  2:974113/1‑151
                                                                   ACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGAATCCTTCGTTG                                                                                       >  2:642134/1‑151
                                                                    CCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGA                                                                                      >  2:196882/1‑151
                                                                                                      GTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATC                                                    <  2:779296/151‑1
                                                                                                             GTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAA                                             >  1:343249/1‑151
                                                                                                                            CTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACC                              <  2:419714/151‑1
                                                                                                                            CTAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACC                              <  2:777593/151‑1
                                                                                                                             TAGCTGCGCGGTCGCCAGCCCCAGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCC                             <  1:634901/151‑1
                                                                                                                                                     CCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCC     <  1:552721/151‑1
                                                                                                                                                     CCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCC     <  1:1134068/151‑1
                                                                                                                                                     CCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCC     >  1:718307/1‑151
                                                                                                                                                        CCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAACAAGCCGACCCTAGCGCAGATACGTTCGCTAGcaccga  >  2:409013/1‑145
                                                                                                                                                                                                                                                                                                               
GCTGGCGGAGCGGTGGCGGGCTCAGTGGTGAAATTGGTCTTAAGCGGAGTGGGCTTCTCCGCTTTAGACCAAGGCCGAGCTTCGAAACCGCGGTCTTTGCGGGTTCGAAGTCGCGCCCACCACTCTAGCTGCGCGGTCGCCAGCCCCAGCCACCGC...................................................................................................................................................  .  NC_013198/2122265‑2122110
....................................................................................................................................................GCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCCCGA  .  NC_013198/2122257‑2122403

Base quality scores:  ATCG  < 3 ≤  ATCG  < 13 ≤  ATCG  < 24 ≤  ATCG  < 32 ≤  ATCG  < 40 ≤  ATCG