New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 72746477 (0.921)46 (0.550) 11/282 2.7 intergenic (+162/‑522) LGG_00716/lexA hypothetical protein/LexA repressor
?NC_013198 = 727579 NA (NA)intergenic (+277/‑407) LGG_00716/lexA hypothetical protein/LexA repressor
Continuation Left: 0 Continuation Right:0

ATGAAACGAGAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGG.....................................................................................................................................................  .  NC_013198/727306‑727464
......................................................................................................................................................CGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGACCTACGACTGCTCCGCTTTGGCAC  .  NC_013198/727579‑727431
                                                                                                                                                                                                                                                                                                                    
ATGAAACGAGAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTC                                                                                                                                                               <  2:839126/151‑1
     ACGAGAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATG                                                                                                                                                          <  1:1161026/151‑1
      CGAGAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGG                                                                                                                                                         <  1:514884/151‑1
                           ACAGCTTCAAAATAGAAGCGTACTATTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAG                                                                                                                                    <  1:394093/151‑1
                            catCTTCAAAATAGAAGCTTTCTATTTCAGTTTTTTACAAGAAATAGTACGCTTTTTTGCTTTGCCGTATTAGGATAAATGGGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:648187/148‑1
                            catCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:203173/148‑1
                            CAGCTTGAAGATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:769367/151‑1
                            CAGCTTCAAAATAGAAGCGTTCTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:254569/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:3706/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:233965/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:1249057/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:544221/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:1175691/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:561728/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:42286/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:386382/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:944913/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:30613/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:158321/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  2:918950/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:262067/151‑1
                            CAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGC                                                                                                                                   <  1:270468/151‑1
                            CAGCGTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGATATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGATCTGTTACGATTCCAGTGCCAAAGCGTAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGtgc                                                                                                                                   <  2:1110244/151‑4
                                  CAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGAC                                                                                                                             <  2:608651/151‑1
                                       TAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGC                                                                                                                        <  2:1121075/151‑1
                                        AGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCT                                                                                                                       <  1:123730/151‑1
                                        AGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCT                                                                                                                       <  1:583437/151‑1
                                                                          GTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCC                                                                                     >  2:50759/1‑151
                                                                              GCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTNNNNNNNNNANTGCCAAANNNNNNNNNNCGNAGGTCGNATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAAC                                                                                 <  1:407437/151‑1
                                                                              GCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAAC                                                                                 <  2:832778/151‑1
                                                                                      GCTTGTCGGTATTAGTATAAATGAGCTTTAACGACTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGTGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAG                                                                         <  2:184036/151‑1
                                                                                                                            AGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGC                                   <  1:365218/151‑1
                                                                                                                             GTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCC                                  <  1:1202099/151‑1
                                                                                                                             GTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCC                                  <  1:304823/151‑1
                                                                                                                             GTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCC                                  <  1:1208823/151‑1
                                                                                                                              TGCCAAAGCGTAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:879603/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCn                                 <  1:833460/151‑2
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:898969/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:871925/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:407898/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:271098/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  2:1095505/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:924714/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:1205321/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:708806/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:50759/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:451982/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:274354/151‑1
                                                                                                                              TGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCC                                 <  1:145678/151‑1
                                                                                                                                                       GGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGACCTACGACTGCTCCGCTT        >  1:139980/1‑151
                                                                                                                                                            GGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGACCTACGACTGCTCCGCTTTGGCA   >  2:985940/1‑151
                                                                                                                                                            GGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGAACTACGACTGCTCCGCTTTGGC  >  2:710895/1‑150
                                                                                                                                                             GGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGACCTACGACTGCTCCGCTTTGGCAC  <  2:1016784/151‑1
                                                                                                                                                                                                                                                                                                                    
ATGAAACGAGAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGG.....................................................................................................................................................  .  NC_013198/727306‑727464
......................................................................................................................................................CGGATGGGGTGGCGACGCGAAGCTAGAGCGGAGACGGCGCTTGGAGCCTGCAAGACCGGCAGTCTCCAAGTCGCCTAACAACATCAGCGACAAAGCCCGGTCGCTGTGTTGTTCCACGGCTGAGCCCCATCCGACCTACGACTGCTCCGCTTTGGCAC  .  NC_013198/727579‑727431

Base quality scores:  ATCG  < 3 ≤  ATCG  < 13 ≤  ATCG  < 25 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG