New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 2122110 =71 (0.843)42 (0.499) 12/284 2.5 intergenic (‑168/+326) efp/yrjD protein elongation factor P/hypothetical protein
?NC_013198 2122257 = 72 (0.810)intergenic (‑315/+179) efp/yrjD protein elongation factor P/hypothetical protein
Continuation Left: 0 Continuation Right:0

Only 100 of 118 total aligned reads displayed.

CCATTGTGCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGCCACCGCTCCG  .  NC_013198/2121962‑2122260
                                                                                                                                                    |                                                                                                                                                      
ccATTGTGCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCcgcg                                                                                                                                                      >  2:390553/1‑151
 tcggtgctagcgaacgtatctgcgctagggtcggcttgtttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCgg                                                                                                                                                     >  2:409013‑M1/148‑151
 cATTGTGCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCgg                                                                                                                                                     <  2:265441/151‑1
    ggcctagcgagcgtatctgcgctagggtcggcttttttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTgg                                                                                                                                                  <  1:552721‑M1/7‑1
    ggcctagcgagcgtatctgcgctagggtcggcttttttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTgg                                                                                                                                                  >  1:718307‑M1/145‑151
    ggcctagcgagcgtatctgcgctagggtcggcttttttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTgg                                                                                                                                                  <  1:1134068‑M1/7‑1
     gtgCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTggc                                                                                                                                                 >  2:622150/1‑151
     gtgCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTggc                                                                                                                                                 >  2:970920/1‑151
                          gAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCTGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAgt                                                                                                                            >  2:498086/1‑150
                             ggtcggcttttttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTag                                                                                                                         <  2:419714‑M1/32‑1
                             ggtcggcttttttggttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTag                                                                                                                         <  2:777593‑M1/32‑1
                                 gacagccATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAgtg                                                                                                                     <  2:643483/146‑1
                                 gTATACCATAATATCTTGTGCGTTAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCTATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAgtg                                                                                                                     <  2:550731/151‑1
                                  tataCCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAgtgg                                                                                                                    <  2:675581/151‑1
                                  tataCCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAgtgg                                                                                                                    <  1:813576/151‑1
                                      ccATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAgtgctgtc                                                                                                                >  1:643615/1‑146
                                      ccATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTggg                                                                                                                >  2:1137807/1‑151
                                      ccATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTggg                                                                                                                >  1:742701/1‑151
                                      ccATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTggg                                                                                                                >  1:1222133/1‑151
                                        ataataCCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGgcg                                                                                                              >  1:1018284/1‑151
                                        ataataCCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGgcg                                                                                                              >  1:1195396/1‑151
                                        ataataCCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGgcg                                                                                                              >  1:766023/1‑151
                                            ttggacagattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGAc                                                                                                          >  1:343249‑M1/105‑151
                                             aCCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACt                                                                                                         >  2:822726/1‑151
                                                   gattatacttatcggattaattggaacgtactcttcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAAc                                                                                                   <  2:779296‑M1/54‑1
                                                                   aactaGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGt                                                                                   >  1:876429/1‑151
                                                                   aactaGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGt                                                                                   >  1:1173867/1‑151
                                                                        gggATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGa                                                                              >  2:250406/1‑151
                                                                        gggATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGa                                                                              >  1:877587/1‑151
                                                                        gggATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGa                                                                              >  1:38182/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCCAAGACCGCGGTTTCGAAGCTCGGc                                                                      >  1:370472/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGc                                                                      >  2:665693/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGc                                                                      >  2:204046/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGc                                                                      >  2:389286/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGGTTCGAAGCTCGGc                                                                      >  2:820499/1‑151
                                                                                gtgtaagtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGGGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGc                                                                      >  2:321402/1‑151
                                                                                     tcaacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTgg                                                                 >  2:196882‑M1/64‑151
                                                                                      gtgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                <  2:469835/151‑1
                                                                                      cagcgaggggtgcgttggggctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:116319‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:147734‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:893607‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:102128‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:1226645‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:755030‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:41304‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:1097900‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:1171301‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:632845‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:419703‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:779478‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:958953‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:777775‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  1:217211‑M1/63‑151
                                                                                      caacgaaggatacgttgagtctcgttgtttgagggcagggatagaaagcaagagctggcggaGCGGTGGCGGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:124368‑M1/63‑151
                                                                                      caacgaaggatacgtggagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGt                                                                >  2:1202217‑M1/63‑151
                                                                                       tgtCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTc                                                               <  1:822959/151‑1
                                                                                       ataagagacagtCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTc                                                               <  2:56853/140‑1
                                                                                            gCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAg                                                          >  1:182224/1‑151
                                                                                            gCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAg                                                          <  2:877270/151‑1
                                                                                            aggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAg                                                          >  2:1224757‑M1/57‑151
                                                                                             ggatgcgttgagtgtggttgttggggtgcagggatagaaaggaaggtcgggcggcGCGGTGGCTCGGGCTGTTTATCGGCGAGCTAGAGGGGTGGGCGCGACTTCGAACCCGTAAAGACCGCGGTTTCGCCGCCCGGCCTTGGtctaatgc                                                         >  2:1034758‑M1/56‑148
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGCCCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  1:696104‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  2:634769‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  1:707931‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  1:550716‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  2:83566‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  2:1068838‑M1/56‑151
                                                                                             ggatacgttgagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  1:952565‑M1/56‑151
                                                                                             ggatacgttgagtctcgtggtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  2:169528‑M1/56‑151
                                                                                             ggatacgtggagtctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         >  2:5720‑M1/56‑151
                                                                                             cccTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGTGGCGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCACGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         <  1:18260/151‑1
                                                                                             cccTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         <  1:390544/151‑1
                                                                                             cccTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGc                                                         <  1:1138173/151‑1
                                                                                                 ttCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGgag                                                     >  2:1017119/1‑151
                                                                                                 ttCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGCTTCGAAGCTCGGCCTTGGTCTAAAGCGgag                                                     >  2:300318/1‑151
                                                                                                  tCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTcctgtctcttat                                                    >  1:56853/1‑140
                                                                                                   ccTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTcctgtctcttata                                                   >  1:1101005/1‑139
                                                                                                   ccTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGGCTAAAGCGGAGaa                                                   >  2:905352/1‑151
                                                                                                       ggTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGccc                                               <  1:665825/151‑1
                                                                                                       ggTTCTACTCTAATTAAGTGAGGTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGccc                                               <  2:182236/151‑1
                                                                                                        gTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCa                                              >  2:1252614/1‑151
                                                                                                        gTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCa                                              >  1:61393/1‑151
                                                                                                         tctcgttgtttgagtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCAc                                             >  2:489891‑M1/44‑151
                                                                                                           cTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTc                                           <  2:38182/151‑1
                                                                                                             aCTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCg                                         >  2:685979/1‑151
                                                                                                             aCTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCg                                         >  2:178497/1‑151
                                                                                                                ctAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGCGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGATTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCCCCCCGCtc                                      >  2:813396/1‑150
                                                                                                                     taagagacagccGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGAc                                 <  2:905970/141‑1
                                                                                                                     tAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGAc                                 <  1:971234/151‑1
                                                                                                                     ggtgcagggatagaaagcaagagctggcggaGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGAc                                 >  2:632751‑M1/32‑151
                                                                                                                     agtgcagggatagaaagcaagagctggcgggGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGAc                                 >  2:481064‑M1/32‑151
                                                                                                                            tttCCGATATCCCGGGGTGTCTCCGCGGTGGCTGGGGCTGGGGTCCGCGCAGCTAGAGTGGTGGGCGCGACTTCGGACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGGCCAATTTc                          <  2:289361/151‑1
                                                                                                                            ggatagaaagcaagagctggcggaGCCGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTc                          >  1:491192‑M1/25‑151
                                                                                                                               ccGTTACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTcacc                       <  1:1238560/151‑1
                                                                                                                               ccGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGAcctgtctctta                       >  1:906286/1‑142
                                                                                                                                    aCTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGa                  >  1:223925/1‑151
                                                                                                                                          aGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGc            >  2:1100527/1‑151
                                                                                                                                             tGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGCCAc         <  2:223939/151‑1
                                                                                                                                              ggCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGCCAcc        >  1:275887/1‑151
                                                                                                                                                    GCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGCCACCGCtccc  <  2:1056454‑M1/151‑2
                                                                                                                                                    |                                                                                                                                                      
CCATTGTGCTGTTATTGCACGTCTCAGAATTTAGTATACCATAATACCTTGTGCGGGAGCCGGCACTAACTAGGGATGAAGTGTAAGTGTCAGCCCTTTCCTTGGTTCTACTCTAATTAAGTGATTTCCGATACTCCGAGCTGGCTCCGCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTCACCACTGAGCCCGCCACCGCTCCG  .  NC_013198/2121962‑2122260

Base quality scores:  ATCG  < 3 ≤  ATCG  < 15 ≤  ATCG  < 25 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG