New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 1058951 =66 (0.752)30 (0.342) 13/296 2.5 coding (53/183 nt) LGG_01046 hypothetical protein
?NC_013198 = 2898115 109 (1.226)coding (225/237 nt) LGG_02835 hypothetical protein
Continuation Left: 0 Continuation Right:0

GTCAGGATCATCTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCACCGGCGCAGAAG  .  NC_013198/1058801‑1059101
                                                                                                                                                      |                                                                                                                                                      
gTCAGGATCATCTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGGACGGGCTCACGAt                                                                                                                                                        >  2:979583/1‑151
   aGGATCATCTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTGTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCAc                                                                                                                                                     <  2:349734/151‑1
      atcatcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCAt                                                                                                                                                  <  2:647899/151‑1
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCCCAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGGACGGGCTCACGGTCACCATaa                                                                                                                                                >  2:578428/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGGGTTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  1:111743/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  2:1077953/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  1:858317/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  1:105786/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGGTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  2:888298/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGGTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCCCGATCACCATaa                                                                                                                                                >  1:203452/1‑151
        catcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGGTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATaa                                                                                                                                                >  2:306835/1‑151
          tcTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAAcg                                                                                                                                              <  2:88229/151‑1
           cTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAAcgc                                                                                                                                             <  1:373478/151‑1
           cTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAAcgc                                                                                                                                             <  1:536835/151‑1
             aaTCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGt                                                                                                                                           >  2:994048/1‑151
             aaTCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGt                                                                                                                                           >  1:953756/1‑151
             aaTCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAAAGCGt                                                                                                                                           >  2:334243/1‑151
                  gTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCAcc                                                                                                                                      >  1:958170/1‑151
                  gTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGGGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCAcc                                                                                                                                      >  1:408036/1‑151
                            gATTCGCCGGCTTGCGGATGTTATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGa                                                                                                                            <  1:539996/151‑1
                            gATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGa                                                                                                                            <  2:957856/151‑1
                                   cGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCgt                                                                                                                     <  1:915665/151‑1
                                   cGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCgt                                                                                                                     <  1:979897/151‑1
                                         gagacagatATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAgg                                                                                                               <  1:238065/145‑1
                                           ggATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGAc                                                                                                             <  2:203465/151‑1
                                                gcccagaaacctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTgg                                                                                                        <  1:914507‑M1/49‑1
                                                atatTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAggctgtctc                                                                                                        >  2:238079/1‑144
                                                atatTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTgg                                                                                                        >  2:482110/1‑151
                                                 cccagaaacctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGt                                                                                                       >  2:108802‑M1/102‑151
                                                  ccagaaacctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTc                                                                                                      <  1:191244‑M1/51‑1
                                                       aacctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAAt                                                                                                 <  1:963353‑M1/56‑1
                                                       aacctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAAt                                                                                                 <  2:941904‑M1/56‑1
                                                         aTCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATgg                                                                                               >  2:847149/1‑151
                                                         aTCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATgg                                                                                               >  2:732139/1‑151
                                                          ctgcacataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGc                                                                                              >  2:268726‑M1/93‑151
                                                             ttACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCaa                                                                                           <  2:1201310/151‑1
                                                               cataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGCGTAAGGACCTTGGGCGCAATGGccaagc                                                                                         <  2:133343‑M1/64‑3
                                                               cataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCAGCGCAGGGACCGGAGTGTAAGGACCTTGGTCGCAATGGccaagc                                                                                         <  2:493755‑M1/64‑3
                                                                ccAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAAcc                                                                                        <  1:30056/151‑1
                                                                ataaggaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGgccaagcc                                                                                        >  1:998482‑M1/87‑148
                                                                     gaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGc                                                                                   <  2:33104‑M1/70‑1
                                                                     gaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGc                                                                                   >  2:963039‑M1/82‑151
                                                                     gaccttgggcgcaatgaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGc                                                                                   >  1:93383‑M1/82‑151
                                                                     aaGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGc                                                                                   <  1:1039434/151‑1
                                                                      ggTGCACGCTCAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGcc                                                                                  <  2:549117/150‑1
                                                                      aGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGcc                                                                                  <  2:1228206/151‑1
                                                                      aGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGcc                                                                                  <  2:1013089/151‑1
                                                                      aGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGcc                                                                                  <  1:281525/151‑1
                                                                       gTGCACGCTCAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGccc                                                                                 >  1:549268/1‑150
                                                                           acgcacAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCAc                                                                             <  1:394723/151‑1
                                                                            cgcacAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACg                                                                            >  2:528818/1‑151
                                                                            cgcacAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTCGGTCGCAATGGCCCAACCCAGGCAATCACg                                                                            >  2:550724/1‑151
                                                                              cacaGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGcc                                                                          >  2:515311/1‑151
                                                                              cacaGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGcc                                                                          >  2:1190628/1‑151
                                                                              cacaGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGcc                                                                          >  1:1192778/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  2:549380/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  1:958042/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  2:75831/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  1:757918/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  1:1202318/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  1:1197422/1‑151
                                                                                  gAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAg                                                                      >  1:62052/1‑151
                                                                                   tgtccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAgg                                                                     >  1:172525‑M1/68‑151
                                                                                    gaccaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGc                                                                    <  1:197506‑M1/85‑1
                                                                                     accaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGcc                                                                   >  2:1183728‑M1/66‑151
                                                                                     accaaagcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGcc                                                                   >  2:827203‑M1/66‑151
                                                                                         gTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACtt                                                               >  1:1105293/1‑151
                                                                                          tCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTa                                                              <  1:1078321/151‑1
                                                                                           gcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTtac                                                             >  1:411250‑M1/60‑150
                                                                                           gcccggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTtac                                                             >  2:914191‑M1/60‑150
                                                                                               ggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  1:161725‑M1/56‑146
                                                                                               ggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  2:197518‑M1/56‑146
                                                                                               ggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  2:191255‑M1/56‑146
                                                                                               ggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  1:745380‑M1/56‑146
                                                                                               ggtcatcacgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  2:1104004‑M1/56‑146
                                                                                               ggTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTc                                                         <  2:957728/151‑1
                                                                                               aagagacaggcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCcacttacactc                                                         >  1:364255‑M1/56‑146
                                                                                                  cattgcgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTTACACTCcga                                                      <  1:706795‑M1/99‑2
                                                                                                  cattgcgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTTACACTCcga                                                      <  1:998876‑M1/99‑2
                                                                                                  cattgcgcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTTACACTCcga                                                      <  1:48539‑M1/99‑2
                                                                                                   tgttgGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGt                                                     >  2:1013698/1‑151
                                                                                                     ttgGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGttt                                                   <  1:515462/151‑1
                                                                                                       gtataagagacagtgTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCt                                                 <  1:723758/138‑1
                                                                                                        gcccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTTACACTCCTGTCTctt                                                <  2:364264‑M1/105‑2
                                                                                                         cccaaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCACTtaaactccgatccctaa                                               <  2:516794‑M1/106‑9
                                                                                                           gagGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAAcc                                             <  1:93753/151‑1
                                                                                                            aaggccacttatgctccggtttctaaccgggctggttcacgcTCACCATAACGCGTTCACCGGCGCAGGGATCGGAGTGTAAGGACCTTGGTCGCAATGGCCAAGCCCAGGCCATCACGCCCAAGGCCacttacactccgatccctaagcg                                            >  1:1130243‑M1/43‑140
                                                                                                                    tggccggggggggCGTTGGGGCACGGGCCCCCGGTCCCCATAACCCCTTCCCCGGCGCAGGGATCTTCGGGGAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGggctggct                                    <  2:111754/139‑1
                                                                                                                    tgTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCtctgtctcttatac                                    >  2:723576/1‑138
                                                                                                                                   ttGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAAc                     <  2:953442/151‑1
                                                                                                                                    tGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAAcg                    <  2:997190/151‑1
                                                                                                                                       ggCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGt                 >  2:687664/1‑151
                                                                                                                                       ggCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGt                 >  1:546643/1‑151
                                                                                                                                            gggCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCAcc            <  1:1014018/151‑1
                                                                                                                                              gCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCACCgg          >  1:596750/1‑151
                                                                                                                                              gCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCACCgg          <  1:306820/151‑1
                                                                                                                                                      TCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCACCGGCGCAGAAg  >  1:1117231‑M1/1‑151
                                                                                                                                                      |                                                                                                                                                      
GTCAGGATCATCTAATCAGTGCCATGACGATTCGCCGGCTTGCGGATGATATTATTGATCTTTACCAGCAAGTGCACGCACAGAAGTAGGTCAAGGGTTTGTTGGTAGAGGTTGGTTGTCTGGCGAGTGCGTTGGGGCACGGGCTCACGATCACCATAACGCGTTCACCGGCGCAGGGATCTGCGTGTAAGGACCTTGGTCGCAATGGCCAAACCCAGGCCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGCTCACGCTCACCATAACGCGTTCACCGGCGCAGAAG  .  NC_013198/1058801‑1059101

Base quality scores:  ATCG  < 3 ≤  ATCG  < 18 ≤  ATCG  < 29 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG