New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 72746477 (0.921)46 (0.550) 11/282 2.7 intergenic (+162/‑522) LGG_00716/lexA hypothetical protein/LexA repressor
?NC_013198 = 727579 NA (NA)intergenic (+277/‑407) LGG_00716/lexA hypothetical protein/LexA repressor
Continuation Left: 0 Continuation Right:0

Only 100 of 127 total aligned reads displayed.

GAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACG  .  NC_013198/727315‑727613
                                                                                                                                                     |                                                                                                                                                     
gagGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGc                                                                                                                                                      <  2:445499/151‑1
 agGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCt                                                                                                                                                     >  1:1000806/1‑151
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:114669/151‑1
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:715157/151‑1
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:206922/151‑1
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:152601/151‑1
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:119096/151‑1
     tGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGc                                                                                                                                                 <  2:422177/151‑1
        gTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGt                                                                                                                                              >  1:39147/1‑151
            tAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGaa                                                                                                                                          <  1:623710/151‑1
            tAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGaa                                                                                                                                          <  2:39147/151‑1
             aaTTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGaac                                                                                                                                         <  1:644051/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagag                                                                                                                                    <  1:394093‑M1/151‑20
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  2:242197/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  1:467207/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  2:171058/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  2:1181694/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  2:590132/151‑1
                  acaGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAacac                                                                                                                                    <  1:608728/151‑1
                   catcttcAAAATAGAAGCTTTCTATTTCAGTTTTTTACAAGAAATAGTACGCTTTTTTGCTTTGCCGTATTAGGATAAATGGGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:648187‑M1/148‑21
                   catcttcAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:203173‑M1/148‑21
                   caGCTTGAAGATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:769367‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTTCTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:254569‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:561728‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:42286‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:1249057‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:386382‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:3706‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:30613‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:270468‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:262067‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:158321‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:544221‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  1:1175691‑M1/151‑21
                   caGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagc                                                                                                                                   <  2:944913‑M1/151‑21
                    aGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAg                                                                                                                                  <  1:702948/151‑1
                         cAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagac                                                                                                                             <  2:608651‑M1/151‑27
                           aaaTAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCgg                                                                                                                           >  2:896273/1‑151
                           aaaTAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCgg                                                                                                                           >  2:520455/1‑151
                              tAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgc                                                                                                                        <  2:1121075‑M1/151‑32
                               aGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgct                                                                                                                       <  1:583437‑M1/151‑33
                                gAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGAGACCGGGCttt                                                                                                                      >  1:570065/1‑151
                                   gCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTc                                                                                                                   <  1:890893/151‑1
                                           tttCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGAtgt                                                                                                           <  1:781593/151‑1
                                               aGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATgttgtt                                                                                                       <  1:851231/151‑1
                                               aGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATgttgtt                                                                                                       <  2:467731/151‑1
                                                  tttttACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAgg                                                                                                    <  1:1039475/151‑1
                                                            aaaTAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGgag                                                                                          <  1:703409/151‑1
                                                                aGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTg                                                                                      >  2:10426/1‑151
                                                                     gCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaac                                                                                 <  2:832778‑M1/151‑71
                                                                             gCTTGTCGGTATTAGTATAAATGAGCTTTAACGACTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggtgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcag                                                                         <  2:184036‑M1/151‑79
                                                                                           gTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGtc                                                           >  2:405877/1‑151
                                                                                           gTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGtc                                                           >  1:986254/1‑151
                                                                                           gTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGtc                                                           >  2:359465/1‑151
                                                                                           gTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGtc                                                           >  1:367659/1‑151
                                                                                                  caggCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGctc                                                    <  2:548051/148‑1
                                                                                                     gCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCTGtctcttatacac                                                 >  2:743085/1‑143
                                                                                                     gCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGctcctg                                                 >  1:548202/1‑148
                                                                                                     gCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAg                                                 >  2:361568/1‑151
                                                                                                     gCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAg                                                 <  1:141957/151‑1
                                                                                                     gCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAg                                                 >  2:139991/1‑151
                                                                                                      cTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGc                                                >  2:478756/1‑151
                                                                                                        ttAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCtt                                              <  2:547182/151‑1
                                                                                                        ttAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCtt                                              <  2:66174/151‑1
                                                                                                        ttAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCtt                                              <  1:350684/151‑1
                                                                                                            cGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTcgcg                                          <  1:232042/151‑1
                                                                                                                   aGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagc                                   <  1:365218‑M1/151‑117
                                                                                                                    gTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagcc                                  <  1:1208823‑M1/151‑118
                                                                                                                    gTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagcc                                  <  1:1202099‑M1/151‑118
                                                                                                                    gTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagcc                                  <  1:304823‑M1/151‑118
                                                                                                                     tGCCAAAGCGTAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  2:879603‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccn                                 <  1:833460‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:145678‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:1205321‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:274354‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  2:407898‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  2:871925‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:451982‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:50759‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:708806‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  1:924714‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  2:1095505‑M1/151‑119
                                                                                                                     tGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccc                                 <  2:898969‑M1/151‑119
                                                                                                                              ggAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATccggcc                        <  1:896590/151‑1
                                                                                                                               gAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATccggccg                       >  2:267016/1‑151
                                                                                                                                    gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGAc                  >  1:339941/1‑151
                                                                                                                                    gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACGGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCCCCCCATCCGGCCGGAGAc                  >  2:918906/1‑151
                                                                                                                                         taagagacaggggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCgg             <  2:863180/142‑1
                                                                                                                                          ggTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGa            >  1:606468/1‑151
                                                                                                                                           gTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAg           >  2:957348/1‑151
                                                                                                                                            gggggtGGGGCGCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGAGGTTGTTAGGCGTCTTGGAGACGGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGt          <  2:901076/146‑1
                                                                                                                                              ggATGGGGtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccccatccgacctacgactgctccgctt        >  1:139980‑M1/1‑8
                                                                                                                                              ggATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGttt        >  1:1021020/1‑151
                                                                                                                                                   gggtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccccatccgaactacgactgctccgctttggcc   >  2:710895‑M1/1‑3
                                                                                                                                                   gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc   <  2:374711/151‑1
                                                                                                                                                   gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc   <  2:265553/151‑1
                                                                                                                                                   gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc   >  2:158238/1‑151
                                                                                                                                                   gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc   <  2:931747/151‑1
                                                                                                                                                   gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc   >  1:1000400/1‑151
                                                                                                                                                    ggtggcgacgcgaagctagagcggagacggcgcttggagcctgcaagaccggcagtctccaagtcgcctaacaacatcagcgacaaagcccggtcgctgtgttgttccacggctgagccccatccgacctacgactgctccgctttggcac  <  2:1016784‑M1/151‑150
                                                                                                                                                     |                                                                                                                                                     
GAGGCTGAGTCATAATTCACAGCTTCAAAATAGAAGCGTACTATTTCAGGTTTTTACAAGAAATAGTACGCTTTTTTGCTTTTCCGTATTAGTATAAATGAGCTTTAACGATTCCAGTGCCAAAGCGGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACG  .  NC_013198/727315‑727613

Base quality scores:  ATCG  < 3 ≤  ATCG  < 18 ≤  ATCG  < 27 ≤  ATCG  < 34 ≤  ATCG  < 40 ≤  ATCG