New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 1058951 =66 (0.752)30 (0.342) 13/296 2.5 coding (53/183 nt) LGG_01046 hypothetical protein
?NC_013198 = 2898115 109 (1.226)coding (225/237 nt) LGG_02835 hypothetical protein
Continuation Left: 0 Continuation Right:0

Only 100 of 144 total aligned reads displayed.

TAAGGATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGGAGAAACT  .  NC_013198/2897965‑2898263
                                                                                                                                                      |                                                                                                                                                    
tAAGGATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGc                                                                                                                                                      <  2:893793/151‑1
tAAGGATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGc                                                                                                                                                      <  1:238867/151‑1
tAAGGATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGc                                                                                                                                                      <  2:643862/151‑1
    gATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtctc                                                                                                                                                  >  1:143256/1‑151
    gATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtctc                                                                                                                                                  >  1:184108/1‑151
          tGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATtat                                                                                                                                            <  1:1145649/151‑1
            gCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATaa                                                                                                                                          <  2:1015191/151‑1
            gCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATaa                                                                                                                                          <  1:1030005/151‑1
            gCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATaa                                                                                                                                          <  1:299860/151‑1
               aGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAAc                                                                                                                                       <  1:938883/151‑1
               aGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAAc                                                                                                                                       <  1:1229843/151‑1
               aGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAAc                                                                                                                                       <  1:33844/151‑1
                ggTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACa                                                                                                                                      >  1:699612/1‑151
                ggTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACa                                                                                                                                      >  1:742936/1‑151
                ggTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACa                                                                                                                                      >  1:1250553/1‑151
                      aaCTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGcc                                                                                                                                <  2:1032599/151‑1
                                   aaaCGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTc                                                                                                                   <  1:88503/151‑1
                                   aaaCGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTc                                                                                                                   <  1:100564/151‑1
                                       gcgcTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAg                                                                                                               >  1:357461/1‑151
                                                 gCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCtctgtctct                                                                                                     >  2:176112/1‑143
                                                 gCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCAGGTCATCACGCCCAAGGCAACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAACGCCCAGACATTGTGTCTGCTCTTTTGAAGt                                                                                                     >  1:465775/1‑151
                                                 gCCCAGAAACCTGCACATAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttgg                                                                                                     <  1:914507‑M2/151‑50
                                                   ccAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCt                                                                                                   >  1:845200/1‑151
                                                   ccAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCt                                                                                                   >  1:1232056/1‑151
                                                      gAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTgg                                                                                                >  1:1040497/1‑151
                                                        aaCCTGCACATAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaat                                                                                              <  1:963353‑M2/151‑57
                                                        aaCCTGCACATAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaat                                                                                              <  2:941904‑M2/151‑57
                                                          ccTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCg                                                                                            >  2:345284/1‑151
                                                           cTGCACATAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggc                                                                                           >  2:268726‑M2/1‑92
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  2:1056981/1‑151
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  1:1064107/1‑151
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  2:327645/1‑151
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  2:510181/1‑151
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  2:90836/1‑151
                                                                caTAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACtttt                                                                                      >  1:316006/1‑151
                                                                caTAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagcgtaaggaccttgggcgcaatggccaagc                                                                                      <  2:133343‑M2/151‑65
                                                                 aTAAGGACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcc                                                                                     >  1:998482‑M2/1‑86
                                                                  agacagccTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTtgg                                                                                    <  2:1062732/145‑1
                                                                     ggACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGTTTCACGCACGCCATTATAAAACAAGATACCAAACTTTCCGTCTGTTCTTTTGAAGTCTTGGCTCGACTTTtggtgg                                                                                 >  1:1034553/1‑151
                                                                      gACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggc                                                                                <  2:33104‑M2/151‑71
                                                                      gACCTTGGGCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggc                                                                                >  1:93383‑M2/1‑81
                                                                        ccTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTtggctgtct                                                                              >  1:1063100/1‑145
                                                                           tGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATc                                                                           >  1:997832/1‑151
                                                                                 cAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACAt                                                                     <  2:107892/151‑1
                                                                                 cAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACAt                                                                     <  1:1158691/151‑1
                                                                                 cAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACAt                                                                     <  2:844883/151‑1
                                                                                 cAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACAt                                                                     <  2:689524/151‑1
                                                                                  aaTGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATc                                                                    <  1:904383/151‑1
                                                                                    tgtccaaaGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaagg                                                                  >  1:172525‑M2/4‑67
                                                                                     gACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggc                                                                 <  1:197506‑M2/151‑86
                                                                                     gACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCaaa                                                                 >  2:238362/1‑151
                                                                                     gACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCaaa                                                                 >  1:792615/1‑151
                                                                                     gACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCaaa                                                                 >  2:1122918/1‑151
                                                                                     gACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCaaa                                                                 >  2:791950/1‑151
                                                                                      aCCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggcc                                                                >  2:1183728‑M2/1‑65
                                                                                       ccgggctttggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAAcc                                                               >  2:1165993/10‑151
                                                                                       ccgggctttggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAAcc                                                               >  2:823431/10‑151
                                                                                       ccgggctttggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAAcc                                                               >  1:337897/10‑151
                                                                                            gCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttac                                                          >  1:411250‑M2/1‑59
                                                                                                ggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  2:1104004‑M2/1‑55
                                                                                                ggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  1:745380‑M2/1‑55
                                                                                                ggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  1:161725‑M2/1‑55
                                                                                                ggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  2:197518‑M2/1‑55
                                                                                                ggTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  2:191255‑M2/1‑55
                                                                                                aagagacaggcccaaggccACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactc                                                      >  1:364255‑M2/10‑55
                                                                                                 gTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTgg                                                     >  1:610575/1‑151
                                                                                                 gTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTgg                                                     >  1:543536/1‑151
                                                                                                   cattgcgcccaAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactccga                                                   <  1:706795‑M2/146‑100
                                                                                                   cattgcgcccaAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactccga                                                   <  1:48539‑M2/146‑100
                                                                                                   catcaCGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGaa                                                   >  1:308658/1‑151
                                                                                                        cGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACaa                                              >  2:823848/1‑151
                                                                                                        cGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACaa                                              >  2:707300/1‑151
                                                                                                         gCCCAAGGCCACTTATGCTCAGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAAc                                             <  2:698707/151‑1
                                                                                                          cccAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttaaactccgatccctaa                                            <  2:516794‑M2/151‑107
                                                                                                           ccAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAAccc                                           <  2:906158/151‑1
                                                                                                             aaGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCtcaccataacgcgttcaccggcgcagggatcggagtgtaaggaccttggtcgcaatggccaagcccaggccatcacgcccaaggccacttacactccgatccctaagcg                                         >  1:1130243‑M2/1‑42
                                                                                                               ggCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCcgac                                       >  2:100700/1‑151
                                                                                                                gCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCcgacg                                      >  1:1129667/1‑151
                                                                                                                  cACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCcgacgac                                    <  2:606377/151‑1
                                                                                                                    cTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCcgacgacga                                  >  1:140419/1‑151
                                                                                                                    cTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCcgacgacga                                  >  2:566937/1‑151
                                                                                                                    cTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACACcgacgacga                                  >  1:118845/1‑151
                                                                                                                      tATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAAc                                <  2:109860/151‑1
                                                                                                                      gtgtataagagacagaaCCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAAc                                <  2:370777/136‑1
                                                                                                                              ggTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCATACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAg                        <  1:834142/151‑1
                                                                                                                                tttCTAACCGGGCTTGTTCACGCTCTCCATTCTAGAACAAAAGCCCAGTCTGTGTGTCTGAGCTGTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACACCAAACCGATGACGTGGAAGCCACCCCCGACGACGAACAGACCAAGaa                      <  2:1034222/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:610431/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:413758/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:285222/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:226856/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:184120/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:919317/151‑1
                                                                                                                                tttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  1:1016258/151‑1
                                                                                                                                gttCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTTTCTGAGCTTTTGAAGTTTTTGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGaa                      <  2:118856/150‑1
                                                                                                                                     aaCCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAAcctgtctcttatacac                 >  1:370768/1‑136
                                                                                                                                              ggTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGga        >  2:687173/1‑151
                                                                                                                                              ggTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGga        >  1:451648/1‑151
                                                                                                                                              ggTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGga        >  1:955084/1‑151
                                                                                                                                               gTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGgag       >  1:184251/1‑151
                                                                                                                                                    cGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGGAGAAACt  <  2:600530/151‑1
                                                                                                                                                      |                                                                                                                                                    
TAAGGATCTCTGGCGAGGTTTAAACTTACCCTCCAAAACGCGCTCACCAGCCCAGAAACCTGCACATAAGGACCTTGGTCGCAATGACCAAAGCCCGGTCATCACGCCCAAGGCCACTTATGCTCCGGTTTCTAACCGGGCTGGTTCACGCTCTCCATTATAAAACAAAAGCCCAGACTTTGTGTCTGAGCTTTTGAAGTCTTGGTTCGACTTTTGGTGGTTGATCTTACATCAAACCGATGACGTGGAAGACAACCCCGACGACGAACAGACCAAGAATGATAATAATTGGAGAAACT  .  NC_013198/2897965‑2898263

Base quality scores:  ATCG  < 3 ≤  ATCG  < 18 ≤  ATCG  < 30 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG