New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 2122110 =71 (0.843)42 (0.499) 12/284 2.5 intergenic (‑168/+326) efp/yrjD protein elongation factor P/hypothetical protein
?NC_013198 2122257 = 72 (0.810)intergenic (‑315/+179) efp/yrjD protein elongation factor P/hypothetical protein
Continuation Left: 0 Continuation Right:0

Only 100 of 118 total aligned reads displayed.

GCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCCCGA  .  NC_013198/2122110‑2122403
                                                                                                                                                    |                                                                                                                                                  
GCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCtccc                                                                                                                                                 <  2:1056454‑M1/151‑2
     GGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGc                                                                                                                                            <  1:437645‑M1/151‑1
          gggctggCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTg                                                                                                                                       >  1:39701/1‑151
           ggctggCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGc                                                                                                                                      <  1:300302/151‑1
            gctggCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCt                                                                                                                                     >  1:428885/1‑151
                   aCCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATc                                                                                                                              <  1:204032/151‑1
                     gaaattggtcttaagcggagtgggcttctccgctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccacggcTCCGCCAGCTCTTGCTTTCTATcc                                                                                                                             >  1:491192‑M2/128‑151
                     cgcgCAGCTGGAGTGGTGGGCGCGACTTCGAACCCGCAAAGCCCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATccc                                                                                                                            <  2:1195030/151‑1
                     cgcgCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATccc                                                                                                                            <  1:498100/151‑1
                       cgcAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTg                                                                                                                          <  1:1056822/151‑1
                       cgcAGCGAGAGTGGGGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTGCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTg                                                                                                                          <  2:1222235/151‑1
                         cAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCa                                                                                                                        >  1:861482/1‑151
                         cAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCa                                                                                                                        >  2:881743/1‑151
                         cAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCa                                                                                                                        >  2:1091577/1‑151
                         cAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCa                                                                                                                        >  1:611930/1‑151
                           gCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACt                                                                                                                      >  2:162072/1‑151
                           gCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACt                                                                                                                      >  2:917390/1‑151
                           gCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGACCCCGCCACCGCTCCGCCAGCTCCTGCTTTCTATCCCTGCACt                                                                                                                      >  1:1222947/1‑151
                            gtcttaagcggagtgggcttctccgctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCacc                                                                                                                      >  2:632751‑M2/121‑150
                            gtcttaagcggagtgggcttctccgctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcCCCGCCAGCTCTTGCTTTCTATCCCTGCACt                                                                                                                      >  2:481064‑M2/121‑151
                              agagTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCaa                                                                                                                   >  2:351635/1‑151
                              agagTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCaa                                                                                                                   >  1:713104/1‑151
                              agagTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCaa                                                                                                                   >  1:41635/1‑151
                               gagTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCaaa                                                                                                                  >  1:1112590/1‑151
                                        gtgggcttctccgctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACgaga                                                                                                          >  2:489891‑M2/109‑151
                                        gcgcGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGAc                                                                                                         <  1:1091945/151‑1
                                        acagagcTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGAc                                                                                                         <  1:1140459/145‑1
                                            agcTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGAcctgt                                                                                                     >  2:1140093/3‑147
                                              cTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACg                                                                                                   >  2:567889/1‑151
                                                   accccGCAAAGCCCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCACCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              <  2:61394/149‑1
                                                   aaCCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              <  2:1112223/151‑1
                                                   aaCCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              <  1:298049/151‑1
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACCACGAGACTCAACGTATcc                                                                                              >  2:169528‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  2:634769‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  1:550716‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  2:83566‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  2:1068838‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  1:952565‑M2/97‑151
                                                    gctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcgggcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATcc                                                                                              >  1:696104‑M2/97‑151
                                                     ctttagaccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCt                                                                                             >  2:1224757‑M2/96‑151
                                                       cGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCg                                                                                          >  2:749830/1‑151
                                                       cGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCg                                                                                          >  2:907983/1‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagcccccgccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCCCTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  2:124368‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAacgagccccaacgcacccctcgctg                                                                                       >  2:116319‑M2/90‑139
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCCACGTATCCTTCGTTg                                                                                       >  2:1202217‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:1171301‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:958953‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:1097900‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:102128‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:1226645‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:837744‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  2:893607‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:779478‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:777775‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:147734‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  2:41304‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:217211‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  2:755030‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  2:632845‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTg                                                                                       >  1:419703‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGCATCCTTCGTTg                                                                                       >  2:974113‑M2/90‑151
                                                           accaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGAATCCTTCGTTg                                                                                       >  2:642134‑M2/90‑151
                                                            ccaaggccgagcttcgaaaccgcggtctttgcgggttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGa                                                                                      >  2:196882‑M2/89‑151
                                                             taCCGCGGTTTGGAAGCTCGGCCTTGGTCTAAACCGGAGAAGCCCACTCCCCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAag                                                                                    <  1:824575/150‑1
                                                             gACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAag                                                                                    >  1:1105102/1‑151
                                                             gACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAag                                                                                    <  1:232913/151‑1
                                                             gACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAag                                                                                    <  1:882060/151‑1
                                                             gACCCCGTTTTCAGAGCTCGGCCTTGGGCTAGAGGGGATAGCCCCAGTCGGCTTAAG.CCTATTTCCACCTCTGCGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAag                                                                                    <  2:464389/151‑1
                                                               ccGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCCCTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAagag                                                                                  <  2:1221767/151‑1
                                                               ccGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAagag                                                                                  <  1:13549/151‑1
                                                                  cgGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCCCTCCGCTTAAGACCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTAc                                                                               <  2:1017964/151‑1
                                                                  cgGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTAc                                                                               <  1:351626/151‑1
                                                                  cgGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTAc                                                                               <  1:686113/151‑1
                                                                           aGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAAtt                                                                      >  2:496523/1‑151
                                                                            gCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTa                                                                     >  2:1133702/1‑151
                                                                                 gCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCg                                                                >  1:1197925/1‑151
                                                                                             aGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  2:437656/151‑1
                                                                                             aGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  1:215175/151‑1
                                                                                             aGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  1:917706/151‑1
                                                                                             aGCGGAGAACCCCACTCCGCTTAAGACCAATTTC.CCCCCTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  2:41635/151‑1
                                                                                             aGCGGAGAACCCCACCCCGCTTAAGTCCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  2:788654/151‑1
                                                                                              gttcgaagtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATc                                                    <  2:779296‑M2/97‑1
                                                                                              gCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCt                                                   <  1:750012/151‑1
                                                                                                 gagaAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTc                                                >  1:350554/1‑151
                                                                                                  agaAGCCCACTCCGCTTAAGACCAATTTC.ACCCCTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTcc                                               <  1:496535/151‑1
                                                                                                     gtcgcgcccaccactctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTccaa                                             >  1:343249‑M2/48‑151
                                                                                                     aGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTccaac                                            >  1:632487/1‑151
                                                                                                             ccGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAg                                    >  1:785808/1‑151
                                                                                                               gCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGcc                                  >  2:138836/1‑151
                                                                                                               gCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGcc                                  >  1:662571/1‑151
                                                                                                                    ctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGAcc                              <  2:777593‑M2/119‑1
                                                                                                                    ctagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGAcc                              <  2:419714‑M2/119‑1
                                                                                                                    aGACCAATTTC.CCCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGAccc                             <  1:1152043/151‑1
                                                                                                                     tagctgcgcggtcgccagccccagccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGAccc                             <  1:634901‑M2/120‑1
                                                                                                                     gACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCt                            <  1:865663/151‑1
                                                                                                                                   acTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATAcgc               <  1:908299/151‑1
                                                                                                                                        gCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATAcgctcgct          >  1:919014/1‑151
                                                                                                                                             ccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGcc     <  1:552721‑M2/144‑1
                                                                                                                                             ccaccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGcc     >  1:718307‑M2/8‑151
                                                                                                                                                ccgcTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAACAAGCCGACCCTAGCGCAGATACGTtcgctagcaccga  >  2:409013‑M2/5‑145
                                                                                                                                                    |                                                                                                                                                  
GCGGTGGCTGGGGCTGGCGACCGCGCAGCTAGAGTGGTGGGCGCGACTTCGAACCCGCAAAGACCGCGGTTTCGAAGCTCGGCCTTGGTCTAAAGCGGAGAAGCCCACTCCGCTTAAGACCAATTTC.ACCACTGAGCCCGCCACCGCTCCGCCAGCTCTTGCTTTCTATCCCTGCACTCAAACAACGAGACTCAACGTATCCTTCGTTGAAGAGTACGTTCCAATTAATCCGATAAGTATAATCTGTCCAACCAAAAAAGCCGACCCTAGCGCAGATACGCTCGCTAGGCCCGA  .  NC_013198/2122110‑2122403

Base quality scores:  ATCG  < 3 ≤  ATCG  < 15 ≤  ATCG  < 25 ≤  ATCG  < 33 ≤  ATCG  < 40 ≤  ATCG