New junction evidence
  seq id position reads (cov) reads (cov) score skew annotation gene product
* ? NC_013198 = 72746477 (0.921)46 (0.550) 11/282 2.7 intergenic (+162/‑522) LGG_00716/lexA hypothetical protein/LexA repressor
?NC_013198 = 727579 NA (NA)intergenic (+277/‑407) LGG_00716/lexA hypothetical protein/LexA repressor
Continuation Left: 0 Continuation Right:0

GGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGCGCGGTA  .  NC_013198/727441‑727727
                                                                                                                                          |                                                                                                                                                    
ggAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATccggcc                                                                                                                                          <  1:896590/151‑1
 gAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATccggccg                                                                                                                                         >  2:267016/1‑151
      gTCGTAGGTCGGATGGGGCTCAGCTGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGAc                                                                                                                                    >  1:319739/1‑151
      gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGGGAc                                                                                                                                    >  2:79907/1‑151
      gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGAc                                                                                                                                    >  1:339941/1‑151
      gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGAc                                                                                                                                    <  2:1000491/151‑1
      gTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACGGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCCCCCCATCCGGCCGGAGAc                                                                                                                                    >  2:918906/1‑151
           taagagacaggggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCgg                                                                                                                               <  2:863180/142‑1
            ggTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGa                                                                                                                              >  1:606468/1‑151
             gTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAg                                                                                                                             >  2:957348/1‑151
              gggggtGGGGCGCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGAGGTTGTTAGGCGTCTTGGAGACGGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGt                                                                                                                            <  2:901076/146‑1
                ggATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGttt                                                                                                                          >  1:1021020/1‑151
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCggctgtctctta                                                                                                                     >  1:863497/1‑141
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     <  2:931747/151‑1
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     >  1:265538/1‑151
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     >  2:158238/1‑151
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     <  2:265553/151‑1
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     <  2:374711/151‑1
                     gggCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCAc                                                                                                                     >  1:1000400/1‑151
                          cAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGccc                                                                                                                <  2:807099/151‑1
                            gCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAg                                                                                                              >  1:952625/1‑151
                             ccGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGa                                                                                                             >  1:63513/1‑151
                               gTGGAACAACACAGNGNCCGGGCTTTGTCGCTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:512515/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  2:1056488/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  2:356573/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  2:828383/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:660178/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:63569/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:520606/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:359456/151‑1
                               gTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:309935/151‑1
                               caggAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAac                                                                                                           <  1:332197/149‑1
                                  gAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAactac                                                                                                        >  1:680104/1‑151
                                  gAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAactac                                                                                                        >  2:144701/1‑151
                                  gAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAactac                                                                                                        >  1:886801/1‑151
                                  gAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAacctg                                                                                                        >  2:332206/1‑148
                                    cagacacAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACtt                                                                                                      <  1:548151/148‑1
                                    acaacaCAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACtt                                                                                                      >  1:1032672/1‑151
                                       acacAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACtttat                                                                                                   <  2:1020700/151‑1
                                       acacAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACttctg                                                                                                   >  2:548000/1‑148
                                           aGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTAc                                                                                               <  1:241629/151‑1
                                            gCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACt                                                                                              <  1:1183913/151‑1
                                                  gggCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCa                                                                                        >  2:532691/1‑151
                                                          tCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGt                                                                                >  2:378261/1‑151
                                                                 tgttgtTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGa                                                                         <  2:367668/151‑1
                                                                       tAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAg                                                                   <  2:319748/151‑1
                                                                       gacaggACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAg                                                                   <  1:168267/146‑1
                                                                        aGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGt                                                                  <  2:586247/151‑1
                                                                            gACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAgctgtc                                                              >  2:168278/1‑146
                                                                              cTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCAt                                                            >  2:698143/1‑151
                                                                                 ggAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATcac                                                         <  1:620337/151‑1
                                                                                  gagaCTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATcaca                                                        <  1:10426/151‑1
                                                                                   agaCTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACAt                                                       <  1:103390/151‑1
                                                                                   agaCTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACAt                                                       <  1:79906/151‑1
                                                                                     aCTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATcc                                                     <  2:163440/151‑1
                                                                                       tGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTg                                                   <  2:133521/151‑1
                                                                                         ccGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTgag                                                 <  1:267001/151‑1
                                                                                           ggTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGAt                                               >  2:665359/1‑151
                                                                                            gTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATc                                              >  2:1054830/1‑151
                                                                                            gTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATc                                              >  1:706434/1‑151
                                                                                                tGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAAt                                          <  1:361559/151‑1
                                                                                                    ggCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATg                                      >  2:785125/1‑151
                                                                                                          aaGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAg                                <  2:706295/151‑1
                                                                                                            gcgcCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGAt                              <  2:952311/151‑1
                                                                                                                   ctcCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTtg                       >  2:997443/1‑151
                                                                                                                     ccGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTtgtg                     >  2:421205/1‑151
                                                                                                                     ccGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTtgtg                     <  1:785312/151‑1
                                                                                                                        ctctAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAgc                  >  2:34734/1‑151
                                                                                                                            aGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGa              >  2:552467/1‑151
                                                                                                                               ttCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGcc           <  2:606322/151‑1
                                                                                                                                     tCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGcgcg     >  2:1185042/1‑151
                                                                                                                                     tCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGcgcg     >  1:294722/1‑151
                                                                                                                                      cGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGCGCgg    >  1:328392/1‑151
                                                                                                                                        ccACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGCGCGGTa  <  1:423474/151‑1
                                                                                                                                          |                                                                                                                                                    
GGAGCAGTCGTAGGTCGGATGGGGCTCAGCCGTGGAACAACACAGCGACCGGGCTTTGTCGCTGATGTTGTTAGGCGACTTGGAGACTGCCGGTCTTGCAGGCTCCAAGCGCCGTCTCCGCTCTAGCTTCGCGTCGCCACCCCATCCGGCCGGAGACTGCGGAGTTTGGCACGGCCCAGAACTACTTTATTTACTTTCTCAGCTATAGTATTCGGATTTTAGTGGGCATCACATCCTGAGATCGAATTATGTCTTAGATTGTTTTGTGAGCGCGAGCCGGCGCGGTA  .  NC_013198/727441‑727727

Base quality scores:  ATCG  < 3 ≤  ATCG  < 20 ≤  ATCG  < 30 ≤  ATCG  < 34 ≤  ATCG  < 41 ≤  ATCG