Predicted mutation
evidence seq id position mutation annotation gene description
RA NC_013198 2,060,386 C→A W87L (TGG→TTG)  gmk guanylate kinase

Read alignment evidence...
  seq id position change freq score reads annotation genes product
*NC_0131982,060,3860C→A100.0% 320.9 75W87L (TGG→TTG) gmkguanylate kinase
Reads supporting (aligned to +/- strand):  new base (33/42):  ref base (0/0):  total (33/42)

ATCTCCTCGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCCAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTTG  .  NC_013198/2060241‑2060533
                                                                                                                                                 |                                                                                                                                                   
aTCTCCTCGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGttc                                                                                                                                                <  1:1002975/151‑1
aTCTCCTCGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGttc                                                                                                                                                <  1:55174/151‑1
     ctcGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTtctc                                                                                                                                           <  1:809172/151‑1
      tcGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTcc                                                                                                                                          <  1:536211/151‑1
       cGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCa                                                                                                                                         >  1:1131546/1‑151
       cGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCa                                                                                                                                         >  2:1218215/1‑151
       cGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCa                                                                                                                                         >  1:781403/1‑151
            aaGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGAc                                                                                                                                    >  2:953697/1‑151
                    gATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtga                                                                                                                            <  2:952694/151‑1
                    gATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtga                                                                                                                            <  2:770122/151‑1
                    gATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtga                                                                                                                            <  2:69310/151‑1
                    gATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtga                                                                                                                            <  1:62030/151‑1
                      gagacagaaaCCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtgatg                                                                                                                          <  1:353942/144‑1
                       cTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtgatga                                                                                                                         >  1:458853/1‑151
                        tttCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGAc                                                                                                                        >  2:791857/1‑151
                        tttCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGAc                                                                                                                        >  1:988822/1‑151
                         ttCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGAcc                                                                                                                       <  1:668026/151‑1
                             aaaCCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGtgatgctgtctc                                                                                                                   >  2:353951/1‑144
                               aCCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATAtt                                                                                                                 >  1:363045/1‑151
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  2:17301/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  2:299678/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  2:345757/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  1:920830/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                >  1:896227/1‑151
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  2:594882/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  2:620331/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  1:1219208/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  1:724020/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                >  2:73518/1‑151
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                <  1:352372/151‑1
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                >  2:906298/1‑151
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                >  1:399033/1‑151
                                ccGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTc                                                                                                                >  1:432621/1‑151
                                     ggATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGc                                                                                                           <  2:29935/151‑1
                                      gATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGcc                                                                                                          <  2:1112510/151‑1
                                         cGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGc                                                                                                       >  2:607430/1‑151
                                              aTGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAg                                                                                                  <  1:236433/151‑1
                                                ggTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTg                                                                                                <  2:895910/151‑1
                                                   cAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACt                                                                                             <  1:607576/151‑1
                                                                    cttcttTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCtt                                                                            >  1:1118670/1‑151
                                                                      tcttTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAg                                                                          >  1:323606/1‑151
                                                                         tttGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCg                                                                       <  2:399042/151‑1
                                                                         tttGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCg                                                                       <  2:998065/151‑1
                                                                              cAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCaaaa                                                                  <  2:558120/151‑1
                                                                                      gAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCgg                                                          <  2:186520/151‑1
                                                                                      gAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCgg                                                          >  1:1014291/1‑151
                                                                                       aaCATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGgt                                                         >  2:862268/1‑151
                                                                                       aaCATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGgt                                                         >  2:791034/1‑151
                                                                                       aaCATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGgt                                                         >  1:888568/1‑151
                                                                                           tACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGtct                                                     >  1:657420/1‑151
                                                                                                     cgcCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAaataata                                           >  2:1070221/1‑151
                                                                                                      gcCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAaataataa                                          <  1:586051/151‑1
                                                                                                      aagagacagaTCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAaataataa                                          <  1:839707/142‑1
                                                                                                        cTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATc                                        <  1:1233668/151‑1
                                                                                                        cTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATc                                        <  1:1217377/151‑1
                                                                                                        cTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATc                                        <  2:670479/151‑1
                                                                                                               aTCCAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAaataataactgtctctt                                 >  2:839390/1‑142
                                                                                                                  cAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGttt                              <  2:617398/151‑1
                                                                                                                  cAAAACGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGttt                              <  2:1109801/151‑1
                                                                                                                     aaCGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGt                           <  2:925013/151‑1
                                                                                                                       cGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTtc                         <  1:774762/151‑1
                                                                                                                       cGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTtc                         <  2:363054/151‑1
                                                                                                                       cGATGCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTtc                         <  2:19346/151‑1
                                                                                                                           gCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCa                     >  2:74794/1‑151
                                                                                                                           gCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCa                     >  1:277465/1‑151
                                                                                                                           gCTTAGGAAGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCa                     >  1:488518/1‑151
                                                                                                                                   aGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCgg             <  1:791224/151‑1
                                                                                                                                   aGGGATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCgg             <  1:575165/151‑1
                                                                                                                                    gggATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGt            >  2:963620/1‑151
                                                                                                                                    gggATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGt            >  1:703924/1‑151
                                                                                                                                    gggATGCTTAGCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGt            <  2:677555/151‑1
                                                                                                                                              gCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTtg  >  1:1039539/1‑151
                                                                                                                                              gCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTtg  >  2:50406/1‑151
                                                                                                                                              gCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTtg  >  1:925364/1‑151
                                                                                                                                              gCCAAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTtg  >  2:1245306/1‑151
                                                                                                                                                 |                                                                                                                                                   
ATCTCCTCGACCAAGCAGGCGATCTTTCAAAACCGTGGGATCGTCAATGGTCAGAAACAAAACGACGACTTCTTTTGGCAGCTCACGAACATACGTAATCGCGCCTTTGGTATCCAAAACGATGCTTAGGAAGGGATGCTTAGCCCAGTTCTTCTCCAGCGACTCATGTGATGACCCATATTCATAGCCGGCATAAGTGACTTTTTCAATAAAATGCTTAGTCGCAAAACTTGCCGGTGTCTCAAAATAATAATCAACCCCGTTTTGTTCTCCAGTCCGCGGTGGCCGCGTTG  .  NC_013198/2060241‑2060533

Base quality scores:  ATCG  < 3 ≤  ATCG  < 26 ≤  ATCG  < 32 ≤  ATCG  < 35 ≤  ATCG  < 41 ≤  ATCG